<?xml version='1.0'?>
<!DOCTYPE art SYSTEM 'http://www.biomedcentral.com/xml/article.dtd'>
<art>
   <ui>1743-422X-5-153</ui>
   <ji>1743-422X</ji>
   <fm>
      <dochead>Research</dochead>
      <bibl>
         <title>
            <p>Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein</p>
         </title>
         <aug>
            <au id="A1">
               <snm>Xu</snm>
               <fnm>Wanhong</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>wanhongxu@hotmail.com</email>
            </au>
            <au id="A2" ca="yes">
               <snm>Coombs</snm>
               <mi>M</mi>
               <fnm>Kevin</fnm>
               <insr iid="I1"/>
               <insr iid="I2"/>
               <email>kcoombs@ms.umanitoba.ca</email>
            </au>
         </aug>
         <insg>
            <ins id="I1">
               <p>Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg, Manitoba R3E 0J9, Canada</p>
            </ins>
            <ins id="I2">
               <p>Manitoba Centre for Proteomics and Systems Biology, 715 McDermot Avenue, Winnipeg, Manitoba R3E 3P4, Canada</p>
            </ins>
         </insg>
         <source>Virology Journal</source>
         <issn>1743-422X</issn>
         <pubdate>2008</pubdate>
         <volume>5</volume>
         <issue>1</issue>
         <fpage>153</fpage>
         <url>http://www.virologyj.com/content/5/1/153</url>
         <xrefbib>
            <pubidlist>
               <pubid idtype="pmpid">19091125</pubid>
               <pubid idtype="doi">10.1186/1743-422X-5-153</pubid>
            </pubidlist>
         </xrefbib>
      </bibl>
      <history>
         <rec>
            <date>
               <day>02</day>
               <month>12</month>
               <year>2008</year>
            </date>
         </rec>
         <acc>
            <date>
               <day>17</day>
               <month>12</month>
               <year>2008</year>
            </date>
         </acc>
         <pub>
            <date>
               <day>17</day>
               <month>12</month>
               <year>2008</year>
            </date>
         </pub>
      </history>
      <cpyrt>
         <year>2008</year>
         <collab>Xu and Coombs; licensee BioMed Central Ltd.</collab>
         <note>This is an Open Access article distributed under the terms of the Creative Commons Attribution License (<url>http://creativecommons.org/licenses/by/2.0</url>), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.</note>
      </cpyrt>
      <abs>
         <sec>
            <st>
               <p>Abstract</p>
            </st>
            <sec>
               <st>
                  <p>Background</p>
               </st>
               <p>The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp) enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses.</p>
            </sec>
            <sec>
               <st>
                  <p>Results</p>
               </st>
               <p>We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode &#955;B RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV) and aquareovirus (AqRV) genome segment and protein sequences. There was ~55% amino acid identity between ARV &#955;B and MRV &#955;3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV &#955;B and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV &#955;3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces.</p>
            </sec>
            <sec>
               <st>
                  <p>Conclusion</p>
               </st>
               <p>The ARV &#955;B and MRV &#955;3 proteins showed the highest ARV:MRV identity values (~55%) amongst all currently known ARV and MRV proteins. This implies significant evolutionary constraints are placed on dsRNA RdRp molecules, particularly in regions comprising the canonical polymerase motifs and residues thought to interact directly with template and nascent mRNA. This may point the way to improved design of anti-viral agents specifically targeting this enzyme.</p>
            </sec>
         </sec>
      </abs>
   </fm>
   <meta>
      <classifications>
         <classification type="bmc" subtype="user_supplied_xml" id="refman"/>
      </classifications>
   </meta>
   <bdy>
      <sec>
         <st>
            <p>Background</p>
         </st>
         <p>The avian reoviruses (ARVs) are members of the family <it>Reoviridae</it>, the only group of dsRNA viruses (out of seven dsRNA virus families) that infect mammals <abbrgrp><abbr bid="B1">1</abbr><abbr bid="B2">2</abbr></abbrgrp>. The ARVs are the prototypic members of syncytia-inducing, non-enveloped viruses within the <it>Orthoreovirus </it>genus. This genus is divided into 3 subgroups: non-syncytia-inducing mammalian reovirus (MRV; subgroup 1; the prototype of the whole genus), avian reovirus and Nelson Bay virus (subgroup 2), and baboon reovirus (subgroup 3) <abbrgrp><abbr bid="B3">3</abbr></abbrgrp>. In contrast to the MRV, which are rarely associated with human pathology <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B4">4</abbr><abbr bid="B5">5</abbr><abbr bid="B6">6</abbr></abbrgrp>, the ARV are significant pathogens of poultry, and cause a variety of diseases, including infectious enteritis in turkeys <abbrgrp><abbr bid="B7">7</abbr></abbrgrp>, viral arthritis/tenosynovitis <abbrgrp><abbr bid="B8">8</abbr></abbrgrp>, "pale bird" and runting-stunting syndromes <abbrgrp><abbr bid="B9">9</abbr></abbrgrp>, and gastroenteritis, hepatitis, myocarditis, and respiratory illness in chickens <abbrgrp><abbr bid="B2">2</abbr><abbr bid="B8">8</abbr><abbr bid="B10">10</abbr></abbrgrp>.</p>
         <p>Like MRV, ARV is a non-enveloped virus with 10 linear double-stranded RNA gene segments surrounded by a double concentric icosahedral capsid shell (inner shell [also called core] and outer shell) of 70&#8211;80 nm diameter <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. The ARV genomic segments can be resolved into three size classes based on their electrophoretic mobilities, designated L (large), M (medium), and S (small) <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr></abbrgrp>. In total, the genomic composition includes 3 large segments (Ll, L2, L3), 3 medium sized segments (Ml, M2, M3), and 4 small segments (S1, S2, S3, S4). Nine of the segments are monocistronic and encode a single different protein <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B13">13</abbr></abbrgrp> while S1 is tricistronic with partially overlapping open reading frames (ORFs) that encode for three proteins <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr></abbrgrp>. Although ARVs share many features with the prototypic MRVs, several notable differences exist including host range, pathogenicity, hemagglutination properties, and syncytium formation <abbrgrp><abbr bid="B11">11</abbr><abbr bid="B12">12</abbr><abbr bid="B16">16</abbr><abbr bid="B17">17</abbr><abbr bid="B18">18</abbr><abbr bid="B19">19</abbr><abbr bid="B20">20</abbr><abbr bid="B21">21</abbr></abbrgrp>.</p>
         <p>Genomic coding differences also exist between MRV and ARV. For example, although the ARV and MRV S1 genome segments encode homologous receptor-binding proteins <abbrgrp><abbr bid="B19">19</abbr><abbr bid="B22">22</abbr><abbr bid="B23">23</abbr></abbrgrp>, the ARV S1 genome segment encodes two additional ARV-specific gene products, one of which is responsible for ARV's unusual cell-cell fusion ability <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B24">24</abbr></abbrgrp>, whereas the MRV S1 segment encodes only one additional protein <abbrgrp><abbr bid="B25">25</abbr></abbrgrp>. In addition, available data <abbrgrp><abbr bid="B12">12</abbr><abbr bid="B26">26</abbr></abbrgrp> suggest each of the homologous orthoreovirus &#955;-class proteins are encoded by different ARV and MRV L-class genome segments. Differences in the functional properties of homologous ARV and MRV proteins have also been reported. For example, two non-homologous dsRNA-binding proteins (the ARV &#963;A core protein and the MRV &#963;3 major outer capsid protein) are predicted to regulate PKR activation <abbrgrp><abbr bid="B27">27</abbr><abbr bid="B28">28</abbr></abbrgrp> while the ARV &#963;A core protein displays nucleoside triphosphate phosphohydrolase (NTPase) activity <abbrgrp><abbr bid="B29">29</abbr></abbrgrp>, ascribed to the non-homologous MRV &#956;2 <abbrgrp><abbr bid="B30">30</abbr></abbrgrp> and &#955;1 <abbrgrp><abbr bid="B31">31</abbr></abbrgrp> core proteins. Based on these early comparative studies, it seems likely that additional analysis of ARV will continue to broaden our understanding of the <it>Reoviridae </it>family, possibly leading to the identification of novel features that impact on the distinct biological and pathogenic properties of ARV.</p>
         <p>Recent advances have allowed sequence determinations of a growing number of virus isolates. Many ARV and MRV genome segment sequences have been reported. In addition, the complete genomic sequences of three prototype strains of MRV have been completed <abbrgrp><abbr bid="B32">32</abbr><abbr bid="B33">33</abbr><abbr bid="B34">34</abbr></abbrgrp>. In contrast, sequence information from ARV isolates is more limited. While the entire complement of S-class genome segments (for example, <abbrgrp><abbr bid="B14">14</abbr><abbr bid="B15">15</abbr><abbr bid="B35">35</abbr><abbr bid="B36">36</abbr><abbr bid="B37">37</abbr><abbr bid="B38">38</abbr><abbr bid="B39">39</abbr></abbrgrp>) and M-class genome segments (for example, <abbrgrp><abbr bid="B40">40</abbr><abbr bid="B41">41</abbr></abbrgrp>) have been determined for some ARV clones, and sequence information is available for some ARV L1 and L3 genome segments <abbrgrp><abbr bid="B42">42</abbr><abbr bid="B43">43</abbr></abbrgrp>, there is, at present, no sequence information for the ARV L2 genome segment. This segment is presumed to encode for the viral RNA-dependent RNA polymerase (RdRp) protein, an essential enzyme for RNA virus replication. Thus, we determined the genomic sequences of the ARV L2 genome segments from two different strains of ARV (ARV138 and ARV176) in order to expand the available ARV sequence database, determine sequences of the ARV RdRp protein, and to delineate conserved structure/function features of this key viral-encoded enzyme.</p>
      </sec>
      <sec>
         <st>
            <p>Methods</p>
         </st>
         <sec>
            <st>
               <p>Cells and viruses</p>
            </st>
            <p>Avian reovirus strain 138 (ARV138) and strain 176 (ARV176) are laboratory stocks. Virus clones were amplified in the continuous quail cell line QM5 in Medium 199 (Gibco) supplemented to contain 7.5% fetal calf serum (Hyclone), 2 mM glutamine, 100 U/ml penicillin, 100 &#956;g/ml streptomycin, and 1 &#956;g/ml amphotericin B, essentially as previously described <abbrgrp><abbr bid="B44">44</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>Sequencing the L2 genome segment</p>
            </st>
            <p>Genomic dsRNA was extracted from amplified virus P2 stocks with phenol/chloroform <abbrgrp><abbr bid="B45">45</abbr></abbrgrp>. The extracted dsRNA were resolved in 10% SDS-PAGE and resolved L1, L2, and L3 segments separately excised. Individual segment gel bands were collected into microcentrifuge tubes, macerated, and incubated in 1&#8211;2 volumes of diffusion buffer (0.5 M ammonium acetate; 10 mM magnesium acetate; 1 mM EDTA, pH 8.0; 0.1% SDS) at 50&#176;C for 30 minutes. The macerated gel pieces were pelleted by centrifugation at 10,000 &#215; g for 1 min, supernatants were collected and dsRNA precipitated by ethanol. Each pellet was dried and resuspended in ddH<sub>2</sub>O for 3' ligation-based RT-PCR. All primers used for ligation, RT-PCR, and sequencing were synthesized by Invitrogen. An anchor primer, P-5' CTTATTTATTTGCGAGATGGTTATCATTTTAATTATCTCCATG 3'-Bio (5'-end phosphorylated and 3'-end biotin-blocked) was ligated to the 3' end of each genome segment, using T4 RNA ligase according to the manufacturer's instructions (Promega Inc., Madison, USA). Ligated products were precipitated by mixing with 1/2 volume of (30% PEG 8000 in 30 mM MgCl<sub>2</sub>), and centrifuged immediately at 10,000 &#215; g for 30 minutes. The supernatants were removed and pellets were dried and dissolved in ddH<sub>2</sub>O for cDNA synthesis. Full-length cDNA copies of each L2 genome segment were synthesized using a primer (24-mer) complementary to the anchor primer by SuperScript&#8482; II reverse transcriptase according to the manufacturer's instructions (Invitrogen). PCR amplification was performed using cDNA, a forward primer (i.e. primer used for RT), and a reverse primer, 5' ACCGAGGAGAGGgatgaataa 3', designed against highly conserved 3'-end nucleotide sequences of currently known consensus ARV L1 and L3 segment plus strands (shown in lower case) by Expand Long Template PCR System (Roche). PCR products used for DNA sequencing were gel purified using QIAquick<sup>&#174; </sup>gel extraction kit according to the manufacturer's instructions (Qiagen).</p>
            <p>DNA sequencing was performed in both directions by use of an ABI Prism BigDye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (Applied Biosystems) and an Applied Biosystems Genetic Analyzer DNA Model 3100. The first two sequencing reactions were performed with the primers used for PCR amplification. Primers for subsequent reactions were designed from newly obtained sequences to completely sequence each full-length PCR product in both directions. Sequences nearer the ends of each segment were determined from PCR products that were amplified with a primer complementary to the anchor primer and an internal gene-specific primer. Sequences obtained from both directions were assembled and checked for accuracy with SeqMan<sup>&#174; </sup>(Lasergene<sup>&#174;</sup>, Version 7.1.0; DNASTAR, Inc.).</p>
         </sec>
         <sec>
            <st>
               <p>Sequence analyses</p>
            </st>
            <p>Sequences were compiled and analyzed using the Lasergene<sup>&#174; </sup>software suite (Version 7.1.0; DNASTAR, Inc.) Pairwise sequence alignments were performed using the Wilbur-Lipman method <abbrgrp><abbr bid="B46">46</abbr></abbrgrp> for highly divergent nucleotide sequences, the Martinez-NW method <abbrgrp><abbr bid="B47">47</abbr></abbrgrp> for closely related nucleotide sequences, and the Lipman-Pearson method <abbrgrp><abbr bid="B48">48</abbr></abbrgrp> for protein alignments in MegAlign<sup>&#174; </sup>(Lasergene<sup>&#174;</sup>). Multiple sequence alignments were performed using Clustal-W <abbrgrp><abbr bid="B49">49</abbr></abbrgrp> and T-Coffee <abbrgrp><abbr bid="B50">50</abbr></abbrgrp>, and alignment adjustments were manually performed as needed in MegAlign<sup>&#174;</sup>. Amino acid alignment images were adjusted in Adobe Photoshop 7.0 (Adobe<sup>&#174;</sup>). Nucleotide compositions and protein molecular weights were calculated by DNA statistics and protein statistics, respectively, in EditSeq<sup>&#174; </sup>(Lasergene<sup>&#174;</sup>). Phylogenetic trees were constructed using Neighbor-Joining and tested with 1000 bootstrap replicates in MEGA version 4 <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>.</p>
         </sec>
         <sec>
            <st>
               <p>3-D structural analyses</p>
            </st>
            <p>Molecular graphics coordinates of the mammalian reovirus (MRV) &#955;3 crystal structure (PDB # 1MUK; <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>), were manipulated with the UCSF Chimera package from the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco (<abbrgrp><abbr bid="B53">53</abbr></abbrgrp>; supported by NIH P41 RR-01081). Resulting images were imported into Adobe Photoshop and assembled with Adobe Illustrator (Adobe).</p>
         </sec>
      </sec>
      <sec>
         <st>
            <p>Results</p>
         </st>
         <p>The sequences of genes that encode the RdRp protein have been determined for a number of members of the <it>Reoviridae </it>family of viruses (Table <tblr tid="T1">1</tblr>). However, this information was lacking for members of the avian orthoreovirus subgroup. We determined the sequences of two different strains' ARV L2 genome segments. The L2 genome segments of ARV138 and ARV176 were determined to be 3829 (GeneBank accession no. <ext-link ext-link-type="gen" ext-link-id="EU707935">EU707935</ext-link>) and 3830 (GeneBank accession no. <ext-link ext-link-type="gen" ext-link-id="EU707936">EU707936</ext-link>) nucleotides long, respectively (Table <tblr tid="T2">2</tblr>). The one-nucleotide length difference is attributed to the 5'-end of the non-translated region of the plus-strand, where ARV138 L2 contains a one-base deletion relative to ARV176 L2. No additional deletions or insertions were found elsewhere in the alignment. The nucleotide identity between ARV138 and ARV176 L2 genome segments is 85% (Table <tblr tid="T3">3</tblr>). BLAST searches indicated the ARV L2 genome segments were most similar to the mammalian reovirus (MRV) and aquareovirus (AqRV) L1 genome segments, which encode the RNA-dependent RNA polymerase <abbrgrp><abbr bid="B54">54</abbr><abbr bid="B55">55</abbr></abbrgrp>. Pairwise sequence comparisons between both of these newly-determined ARV genome segments and all currently available homologous MRV and AqRV L1 genome segments (see Table <tblr tid="T1">1</tblr>) showed a range of nucleotide and protein identity values. Preliminary comparative studies of all currently available AqRV L-class genome segments indicated that the grass carp reovirus (GCRV) and chum salmon reovirus (CSRV) L genes were the most distantly related amongst the AqRV (data not shown). Thus, although all currently available ARV, MRV, and AqRV L-class genome segments were aligned and compared in subsequent analyses, we limited presentation in subsequent tables and figures to these few most-distant clones for clarity. In addition, preliminary attempts to align the ARV138 and ARV176 L2 genome segments with homologous genes in other <it>Reoviridae </it>genera (<it>ie</it>. the Fijivirus <it>Nilaparvata lugens</it>, the Dinovernavirus <it>Aedes pseudoscutellaris</it>, the Coltivirus Eyach virus, the Orbivirus St. Croix River virus, the Seadornavirus Kadipiro virus, the Mimoreovirus <it>Micromonas pusilla </it>reovirus, and the currently unclassified virus <it>Operophtera brumata </it>reovirus) resulted in much lower identity values and significant gaps (data not shown); thus, these other more-distant genera were not included in subsequent analyses. Pairwise nucleotide sequence comparisons between ARV L2 and homologous MRV genome segments showed identities of ~55%, and pairwise nucleotide sequence comparisons of ARV L2 with AqRV homologues revealed ~48% identity (Table <tblr tid="T3">3</tblr>).</p>
         <tbl id="T1">
            <title>
               <p>Table 1</p>
            </title>
            <caption>
               <p>Nucleotide sequences used in this study</p>
            </caption>
            <tblbdy cols="2">
               <r>
                  <c ca="left">
                     <p>Strain</p>
                  </c>
                  <c ca="left">
                     <p>GenBank Accession Number</p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ARV<sup>a</sup></p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>138</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="EU707935">EU707935</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>176</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="EU707936">EU707936</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>MRV<sup>b</sup></p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>T1L</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="NC_004271">NC_004271</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>T2J</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="NC_004272">NC_004272</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>T3D</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="EF494435">EF494435</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>T4N</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="AF368033">AF368033</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>BYD1</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="DQ664184">DQ664184</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>SC-A</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="DQ997719">DQ997719</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>AqRV<sup>c</sup></p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>GCRV</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="AF260512">AF260512</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>GCHV</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="AF284502">AF284502</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>GSRV</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="NC_005167">NC_005167</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>AGCRV</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="NC_010585">NC_010585</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>CSRV</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="NC_007583">NC_007583</ext-link>
                     </p>
                  </c>
               </r>
               <r>
                  <c cspan="2">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c indent="1" ca="left">
                     <p>ASRV</p>
                  </c>
                  <c ca="left">
                     <p>
                        <ext-link ext-link-type="gen" ext-link-id="EF434978">EF434978</ext-link>
                     </p>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><sup>a </sup>ARV, avian reovirus.</p>
               <p><sup>b </sup>MRV, mammalian reovirus. T1L, type 1Lang; T2J, type 2 Jones; T3D, type 3 Dearing; T4N, type 4 Ndelle.</p>
               <p><sup>c </sup>AqRV, Aquareovirus. GCRV, Grass carp reovirus; GCHV, Grass carp hemorrhagic virus; GSRV, Golden shiner reovirus; AGCRV, American grass carp reovirus; CSRV, Chum salmon reovirus; ASRV, Atlantic salmon reovirus.</p>
            </tblfn>
         </tbl>
         <tbl id="T2">
            <title>
               <p>Table 2</p>
            </title>
            <caption>
               <p>Genome-segment lengths, non-translated regions, and encoded proteins of ARV138 and ARV176</p>
            </caption>
            <tblbdy cols="9">
               <r>
                  <c ca="center">
                     <p>Genome segment</p>
                  </c>
                  <c ca="center">
                     <p>Base pairs<sup>a</sup></p>
                  </c>
                  <c ca="left">
                     <p>5' NTR<sup>b</sup></p>
                  </c>
                  <c ca="left">
                     <p>3' NTR</p>
                  </c>
                  <c ca="left">
                     <p>ORF<sup>c</sup></p>
                  </c>
                  <c ca="left">
                     <p>Codons<sup>d</sup></p>
                  </c>
                  <c ca="left">
                     <p>Protein</p>
                  </c>
                  <c cspan="2" ca="center">
                     <p>Molecular weight (kDa)<sup>e</sup></p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>(no. of bases)</p>
                  </c>
                  <c ca="left">
                     <p>(no. of bases)</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="left">
                     <p>ARV138</p>
                  </c>
                  <c ca="left">
                     <p>ARV176</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>L1<sup>f</sup></p>
                  </c>
                  <c ca="right">
                     <p>3958</p>
                  </c>
                  <c ca="right">
                     <p>20</p>
                  </c>
                  <c ca="right">
                     <p>56</p>
                  </c>
                  <c ca="right">
                     <p>21&#8211;3899</p>
                  </c>
                  <c ca="right">
                     <p>1293</p>
                  </c>
                  <c ca="right">
                     <p>&#955;A</p>
                  </c>
                  <c ca="right">
                     <p>142.3</p>
                  </c>
                  <c ca="right">
                     <p>142.2</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>L2</p>
                  </c>
                  <c ca="right">
                     <p>3829<sup>g</sup></p>
                  </c>
                  <c ca="right">
                     <p>13<sup>h</sup></p>
                  </c>
                  <c ca="right">
                     <p>36</p>
                  </c>
                  <c ca="right">
                     <p>14&#8211;3790<sup>i</sup></p>
                  </c>
                  <c ca="right">
                     <p>1259</p>
                  </c>
                  <c ca="right">
                     <p>&#955;B</p>
                  </c>
                  <c ca="right">
                     <p>139.7</p>
                  </c>
                  <c ca="right">
                     <p>139.8</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>L3<sup>f</sup></p>
                  </c>
                  <c ca="right">
                     <p>3907</p>
                  </c>
                  <c ca="right">
                     <p>12</p>
                  </c>
                  <c ca="right">
                     <p>37</p>
                  </c>
                  <c ca="right">
                     <p>13&#8211;3867</p>
                  </c>
                  <c ca="right">
                     <p>1285</p>
                  </c>
                  <c ca="right">
                     <p>&#955;C</p>
                  </c>
                  <c ca="right">
                     <p>141.9</p>
                  </c>
                  <c ca="right">
                     <p>142.2</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>M1</p>
                  </c>
                  <c ca="right">
                     <p>2283</p>
                  </c>
                  <c ca="right">
                     <p>12</p>
                  </c>
                  <c ca="right">
                     <p>72</p>
                  </c>
                  <c ca="right">
                     <p>13&#8211;2208</p>
                  </c>
                  <c ca="right">
                     <p>732</p>
                  </c>
                  <c ca="right">
                     <p>&#956;A</p>
                  </c>
                  <c ca="right">
                     <p>82.0</p>
                  </c>
                  <c ca="right">
                     <p>82.2</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>M2</p>
                  </c>
                  <c ca="right">
                     <p>2158</p>
                  </c>
                  <c ca="right">
                     <p>29</p>
                  </c>
                  <c ca="right">
                     <p>98</p>
                  </c>
                  <c ca="right">
                     <p>30&#8211;2057</p>
                  </c>
                  <c ca="right">
                     <p>676</p>
                  </c>
                  <c ca="right">
                     <p>&#956;B</p>
                  </c>
                  <c ca="right">
                     <p>73.1</p>
                  </c>
                  <c ca="right">
                     <p>73.3</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>M3</p>
                  </c>
                  <c ca="right">
                     <p>1996</p>
                  </c>
                  <c ca="right">
                     <p>24</p>
                  </c>
                  <c ca="right">
                     <p>64</p>
                  </c>
                  <c ca="right">
                     <p>25&#8211;1929</p>
                  </c>
                  <c ca="right">
                     <p>635</p>
                  </c>
                  <c ca="right">
                     <p>&#956;C</p>
                  </c>
                  <c ca="right">
                     <p>70.9</p>
                  </c>
                  <c ca="right">
                     <p>70.8</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>S1</p>
                  </c>
                  <c ca="right">
                     <p>1643</p>
                  </c>
                  <c ca="right">
                     <p>24</p>
                  </c>
                  <c ca="right">
                     <p>33</p>
                  </c>
                  <c ca="right">
                     <p>25&#8211;318</p>
                  </c>
                  <c ca="right">
                     <p>98</p>
                  </c>
                  <c ca="right">
                     <p>p10</p>
                  </c>
                  <c ca="right">
                     <p>10.3</p>
                  </c>
                  <c ca="right">
                     <p>10.3</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="right">
                     <p>293&#8211;730</p>
                  </c>
                  <c ca="right">
                     <p>146</p>
                  </c>
                  <c ca="right">
                     <p>p17</p>
                  </c>
                  <c ca="right">
                     <p>16.9</p>
                  </c>
                  <c ca="right">
                     <p>16.9</p>
                  </c>
               </r>
               <r>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="right">
                     <p>630&#8211;1607</p>
                  </c>
                  <c ca="right">
                     <p>326</p>
                  </c>
                  <c ca="right">
                     <p>&#963;C</p>
                  </c>
                  <c ca="right">
                     <p>34.9</p>
                  </c>
                  <c ca="right">
                     <p>34.8</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>S2</p>
                  </c>
                  <c ca="right">
                     <p>1324</p>
                  </c>
                  <c ca="right">
                     <p>15</p>
                  </c>
                  <c ca="right">
                     <p>58</p>
                  </c>
                  <c ca="right">
                     <p>16&#8211;1263</p>
                  </c>
                  <c ca="right">
                     <p>416</p>
                  </c>
                  <c ca="right">
                     <p>&#963;A</p>
                  </c>
                  <c ca="right">
                     <p>46.1</p>
                  </c>
                  <c ca="right">
                     <p>46.1</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>S3</p>
                  </c>
                  <c ca="right">
                     <p>1202</p>
                  </c>
                  <c ca="right">
                     <p>30</p>
                  </c>
                  <c ca="right">
                     <p>68</p>
                  </c>
                  <c ca="right">
                     <p>31&#8211;1131</p>
                  </c>
                  <c ca="right">
                     <p>367</p>
                  </c>
                  <c ca="right">
                     <p>&#963;B</p>
                  </c>
                  <c ca="right">
                     <p>40.9</p>
                  </c>
                  <c ca="right">
                     <p>40.9</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>S4</p>
                  </c>
                  <c ca="right">
                     <p>1192</p>
                  </c>
                  <c ca="right">
                     <p>23</p>
                  </c>
                  <c ca="right">
                     <p>65</p>
                  </c>
                  <c ca="right">
                     <p>24&#8211;1124</p>
                  </c>
                  <c ca="right">
                     <p>367</p>
                  </c>
                  <c ca="right">
                     <p>&#963;NS</p>
                  </c>
                  <c ca="right">
                     <p>40.5</p>
                  </c>
                  <c ca="right">
                     <p>40.6</p>
                  </c>
               </r>
               <r>
                  <c ca="center">
                     <p>Total</p>
                  </c>
                  <c ca="right">
                     <p>23492<sup>j</sup></p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><sup>a </sup>Total nucleotides on each strand.</p>
               <p><sup>b</sup>NTR, non-translated region.</p>
               <p><sup>c</sup>Nucleotide positions indicated for starting and ending codons.</p>
               <p><sup>d</sup>Total number of amino acids in deduced protein.</p>
               <p><sup>e</sup>Molecular weight calculated from deduced protein and rounded to closest 0.1 kDa.</p>
               <p><sup>f</sup>Unpublished.</p>
               <p><sup>g</sup>3830 for ARV176.</p>
               <p><sup>h</sup>14 for ARV176.</p>
               <p><sup>i</sup>15&#8211;3791 for ARV176.</p>
               <p><sup>j </sup>23,493 for ARV176.</p>
            </tblfn>
         </tbl>
         <tbl id="T3">
            <title>
               <p>Table 3</p>
            </title>
            <caption>
               <p>Percent identities of the ARV L2 genome segments and homologous encoded proteins of MRV and Aquareoviruses<sup>a</sup></p>
            </caption>
            <tblbdy cols="9">
               <r>
                  <c ca="left">
                     <p>Strain</p>
                  </c>
                  <c ca="center">
                     <p>ARV138</p>
                  </c>
                  <c ca="center">
                     <p>ARV176</p>
                  </c>
                  <c ca="center">
                     <p>T1L</p>
                  </c>
                  <c ca="center">
                     <p>T2J</p>
                  </c>
                  <c ca="center">
                     <p>T3D</p>
                  </c>
                  <c ca="center">
                     <p>T4N</p>
                  </c>
                  <c ca="center">
                     <p>GCRV</p>
                  </c>
                  <c ca="center">
                     <p>CSRV</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ARV138</p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>98</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>41</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>ARV176</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>85</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>55</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>41</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>T1L</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>55</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>55</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>92</p>
                  </c>
                  <c ca="center">
                     <p>99</p>
                  </c>
                  <c ca="center">
                     <p>97</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>41</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>T2J</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>55</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>55</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>75</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>92</p>
                  </c>
                  <c ca="center">
                     <p>91</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>40</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>T3D</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>55</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>55</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>96</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>76</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>98</p>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>41</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>T4N</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>56</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>56</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>89</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>75</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>90</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>42</p>
                  </c>
                  <c ca="center">
                     <p>41</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>GCRV</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>49</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>49</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>48</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>48</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
                  <c ca="center">
                     <p>58</p>
                  </c>
               </r>
               <r>
                  <c cspan="9">
                     <hr/>
                  </c>
               </r>
               <r>
                  <c ca="left">
                     <p>CSRV</p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>46</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>47</b>
                     </p>
                  </c>
                  <c ca="center">
                     <p>
                        <b>59</b>
                     </p>
                  </c>
                  <c>
                     <p/>
                  </c>
               </r>
            </tblbdy>
            <tblfn>
               <p><sup>a </sup>Percent amino acid identities indicated in upper triangle; percent nucleotide identities are in lower triangle, in bold.</p>
            </tblfn>
         </tbl>
         <p>The predicted open reading frames for both ARV L2 segments were determined to be nucleotides 14&#8211;3790 for ARV138 L2 and 15&#8211;3791 for ARV176 L2, resulting in deduced &#955;B proteins of 1259 residues (Table <tblr tid="T2">2</tblr>). The calculated molecular weights for ARV138 &#955;B and ARV176 &#955;B are ~140 kDa each (Table <tblr tid="T2">2</tblr>). The amino acid identity between the two ARV &#955;B proteins is 97.5%, with no insertions or deletions relative to one another. ARV protein &#955;B is the only ARV protein whose sequence has not been reported previously. Thus, completion of the L2 sequence in this study has allowed us to assign its function at the sequence level. Amino acid alignments of ARV &#955;B, MRV &#955;3, and AqRV VP2 proteins revealed several regions of high amino acid identity (Fig. <figr fid="F1">1</figr>), many of which correspond to previously identified polymerase domains <abbrgrp><abbr bid="B56">56</abbr></abbrgrp>. A large number of amino acids were completely conserved across all 14 currently known ARV, MRV, and AqRV RdRp protein sequences (Fig. <figr fid="F1">1</figr>, closed circles). Amino acid identities between ARV &#955;B and homologous MRV &#955;3 or AqRV VP2 are ~55% and ~42%, respectively (Table <tblr tid="T3">3</tblr>), suggesting the ARV and MRV are more closely related to each other than either are to AqRV (also seen in phylogenetic analysis &#8211; Fig. <figr fid="F2">2</figr>), reflecting that ARV and MRV belong to different species in the <it>Orthoreovirus </it>genus <abbrgrp><abbr bid="B36">36</abbr></abbrgrp> whereas AqRV are members of the different <it>Aquareovirus </it>genus in the <it>Reoviridae </it>family. Window-averaged analysis of ARV &#955;B and MRV &#955;3 protein identities (Fig. <figr fid="F3">3</figr>, dashed lines) revealed several regions of high amino acid identity. The highest identity scores, with window-averaged identity values > 90%, were located within canonical polymerase regions, including "fingers" domains (MRV residues 452 &#8211; 467 and 514 &#8211; 530) "fingers"/"palm" interface domains (MRV residues 542 &#8211; 571 and 673 &#8211; 699), "palm" domains (MRV residues 725 &#8211; 738, which includes the GDD motif, which is common to all viral RNA-dependent RNA polymerases <abbrgrp><abbr bid="B57">57</abbr><abbr bid="B58">58</abbr><abbr bid="B59">59</abbr></abbrgrp>), "thumb" domains (MRV residues 864 &#8211; 878), and an "undefined" domain (MRV residues 881 &#8211; 896). Addition of the AqRV VP2 protein to the above analyses provided additional information about potentially important conserved domains. Clustal-W (Fig. <figr fid="F1">1</figr>) and T-Coffee (data not shown) alignments identified 359 amino acid residues that were identical in the 6 aligned sequences (overall average identity = 28.3% Fig. <figr fid="F3">3</figr>, horizontal solid line]). There were numerous window-averaged regions of very low conservation, with most attributed to AqRV regions that were poorly conserved compared to corresponding ARV/MRV regions, a feature also noted in MRV:AqRV comparisons <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>. Three regions showed higher-than-average conservation in the ARV:MRV:AqRV alignments, with window-averaged identity values > 75%, suggesting these polymerase regions (ARV residues G<sub>516</sub>LRNQVQRRPRTIMP<sub>530</sub>, H<sub>542</sub>TLS/CADYINYHMNLSTTSGSAV<sub>563</sub>, and T<sub>677</sub>TTFPSGSTATSTEHTANNSTM<sub>698</sub>, that correspond to MRV residues G<sub>516</sub>LRNQVQRRPRSIMP<sub>530</sub>, H<sub>542</sub>TLTADYINYHMNLSTTSGSAV<sub>563</sub>, and T<sub>677</sub>TTFPSGSTATSTEHTANNSTM<sub>698</sub>, respectively) contain important structural/functional domains. The GDD motif was located within a region of slightly lower window-averaged scores (~60%), but in a sequence (in ARV) I<sub>724</sub>QxxYVCQGDDG<sub>735 </sub>that, apart from the residues at positions 726 and 727, were completely conserved in all 14 currently-available ARV, MRV, and AqRV RdRp sequences. In addition to the 359 identical residues found in all 6 sequences discussed above, blossum50 weighting alignments indicated that an additional 206 positions contained either identical amino acid residues or conservative substitutions in at least 4 of the 6 aligned sequences.</p>
         <fig id="F1">
            <title>
               <p>Figure 1</p>
            </title>
            <caption>
               <p>Alignment of the deduced ARV138 and ARV176 &#955;B amino acid sequences</p>
            </caption>
            <text>
               <p><b>Alignment of the deduced ARV138 and ARV176 &#955;B amino acid sequences</b>. All 14 currently available homologous ARV &#955;B, MRV &#955;3, and AqRV VP2 proteins (determined for each clone shown in Table 1) were aligned, both by T-Coffee <abbrgrp><abbr bid="B50">50</abbr></abbrgrp> (data not shown) and by Clustal-W <abbrgrp><abbr bid="B49">49</abbr></abbrgrp>, with only minor differences in the alignments created by different gap penalties (data not shown). Only the two most-distant ARV, MRV, and AqRV sequences (see text for details) are shown for clarity. Clones are: MRV &#8211; T1L (GenBank No. <ext-link ext-link-type="gen" ext-link-id="NC_004271">NC_004271</ext-link>) and T2J (GenBank No. <ext-link ext-link-type="gen" ext-link-id="NC_004272">NC_004272</ext-link>); ARV &#8211; ARV138 (GenBank No. <ext-link ext-link-type="gen" ext-link-id="EU707935">EU707935</ext-link>) and ARV176 (GenBank No. <ext-link ext-link-type="gen" ext-link-id="EU707936">EU707936</ext-link>); AqRV &#8211; Grass Carp reovirus (GCRV) (GenBank No. <ext-link ext-link-type="gen" ext-link-id="AF260512">AF260512</ext-link>) and Chum Salmon reovirus (CSRV) (GenBank No. <ext-link ext-link-type="gen" ext-link-id="NC_007583">NC_007583</ext-link>). Amino acid residues that are identical in at least four of the sequences are indicated by black background shading. The single letter amino acid code is used. Previously identified polymerase domains (labeled I &#8211; III) <abbrgrp><abbr bid="B56">56</abbr></abbrgrp> are indicated with solid horizontal lines above the sequences. Amino acid residues that are completely conserved in all 14 sequences are indicated by closed circles, and the GDD motif found in all polymerases is indicated by open circles, shown above the sequences.</p>
            </text>
            <graphic file="1743-422X-5-153-1"/>
         </fig>
         <fig id="F2">
            <title>
               <p>Figure 2</p>
            </title>
            <caption>
               <p>Phylogenetic tree analyses of the prototype ARV L2 genome segments and homologous genes in other reoviruses</p>
            </caption>
            <text>
               <p><b>Phylogenetic tree analyses of the prototype ARV L2 genome segments and homologous genes in other reoviruses</b>. Abbreviations are as defined in the legend to Fig. 1. Lines are proportional in length to nucleotide substitution. Alignments were performed by Neighbor-Joining and tested with 1000 bootstrap replicates in MEGA version 4 <abbrgrp><abbr bid="B51">51</abbr></abbrgrp>.</p>
            </text>
            <graphic file="1743-422X-5-153-2"/>
         </fig>
         <fig id="F3">
            <title>
               <p>Figure 3</p>
            </title>
            <caption>
               <p>Window-averaged scores for sequence identity among the ARV &#955;B, AqRV VP2, and MRV &#955;3 RNA-dependent RNA polymerase proteins</p>
            </caption>
            <text>
               <p><b>Window-averaged scores for sequence identity among the ARV &#955;B, AqRV VP2, and MRV &#955;3 RNA-dependent RNA polymerase proteins</b>. To provide consistent weighting to the averaged scores, only the two most-distant clones from each of the three groups (ARV: ARV138 and ARV176; AqRV: GCRV and CSRV; MRV: T1L and T2J &#8211; see text for details) were used. Identity scores averaged over running windows of 15 amino acids and centered at consecutive amino acid positions are shown for ARV:MRV comparisons (dashed lines) and ARV:MRV:AqRV comparisons (solid line). The global identity scores for each of the compared sequence sets are indicated by the horizontal lines. Previously-identified enzymatic motifs are indicated with boxes below the plots.</p>
            </text>
            <graphic file="1743-422X-5-153-3"/>
         </fig>
      </sec>
      <sec>
         <st>
            <p>Discussion</p>
         </st>
         <p>The atomic structure of few ARV proteins have been reported <abbrgrp><abbr bid="B61">61</abbr></abbrgrp>, and such high-resolution structures are not known for any &#955;-class ARV proteins. By contrast, atomic structures are known for most MRV proteins, including the RdRp <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>. Comparative sequence analyses described in this report have indicated that ARV and MRV RdRp proteins share ~55% amino acid identity, ARV and AqRV RdRp proteins share ~42% identity, and that only 359 (~28%) amino acids are completely conserved (identical) when ARV138, ARV176, MRV T1L, MRV T2J, AqRV CSRV, and AqRV GCRV are aligned (Fig. <figr fid="F1">1</figr>). Thus, to gain structure/function information about this key viral-encoded enzyme, ARV, MRV, and AqRV identical amino acids, conservative substitutions, and non-conservative substitutions were modeled in the MRV &#955;3 crystal structure (Fig. <figr fid="F4">4</figr>). This comparative analysis indicated that most non-conserved amino acids were located on the surfaces of the protein exposed to the core interior and in the N-terminal and C-terminal bracelet domains, whereas most identical amino acids and conservative substitutions were located within canonical fingers, palm, and thumb polymerase motifs, particularly those lining channels used by template and nascent RNA during transcription (Fig. <figr fid="F4">4</figr>). Similar observations had been reported from MRV:AqRV comparisons <abbrgrp><abbr bid="B60">60</abbr></abbrgrp> and our results support and extend these earlier observations. As was previously reported from MRV:AqRV comparisons <abbrgrp><abbr bid="B60">60</abbr></abbrgrp>, conserved residues surround the GDD motif and additional residues shown to be important for a variety of polymerase functions are also conserved, including Arg<sub>522</sub>, Arg<sub>523</sub>, Arg<sub>525</sub>, Ala<sub>587 </sub>(which are needed to properly position the incoming NTP triphosphate), Ile<sub>527 </sub>and Pro<sub>529 </sub>(needed to help position template nucleosides), Thr<sub>557</sub>, Ser<sub>558</sub>, Gly<sub>559</sub>, Ser<sub>560</sub>, and Val<sub>562 </sub>(portions of a loop that maintains priming NTP), and Asp<sub>589</sub>, Ser<sub>681</sub>, and Gln<sub>731 </sub>(specifies ribonucleotides). Each of these residues is located one amino acid more N-terminal in the MRV sequence (ie. ARV Arg<sub>522 </sub>= MRV Arg<sub>523 </sub>and all (as well as numerous others) are completely conserved in all 14 currently available ARV, MRV, and AqRV RdRp sequences (Fig. <figr fid="F1">1</figr>, indicated by closed circles). In addition, our comparative analyses indicated many identical amino acids and conservative substitutions were located on the surface of the protein that is predicted to interact with the core shell <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>. This might imply that conserved domains are needed to help tether the RdRp to the underside of the core shell. This hypothesis could be tested by extending such ARV:MRV:AqRV sequence comparisons to the other core proteins.</p>
         <fig id="F4">
            <title>
               <p>Figure 4</p>
            </title>
            <caption>
               <p>Localization of conserved, non-conserved, and identical amino acids in ARV, MRV, and AqRV RdRp proteins</p>
            </caption>
            <text>
               <p><b>Localization of conserved, non-conserved, and identical amino acids in ARV, MRV, and AqRV RdRp proteins</b>. The MRV &#955;3 crystal structure (PDB # 1MUK <abbrgrp><abbr bid="B52">52</abbr></abbrgrp>) was manipulated with Chimera <abbrgrp><abbr bid="B53">53</abbr></abbrgrp>. <b>A</b>, Low-resolution, cutaway model of the reovirus core structure (modified from <abbrgrp><abbr bid="B26">26</abbr></abbrgrp> with permission). <b>B</b>, Blow-up of indicated &#955;3 molecule in 'A', and <b>C</b>, cut-away of "B" with presumptive paths of genomic (+) RNA (black line), template genomic (-) RNA (magenta line) and nascent mRNA (dark green line) shown (adapted from and as described in <abbrgrp><abbr bid="B62">62</abbr></abbrgrp>); Specific motifs in 'B' &#8211; 'O' are color-coded, with N-terminal region in yellow, C-terminal "bracelet" in grey, and canonical polymerase "fingers", "palm", and "thumb" depicted in blue, red, and green, respectively. <b>D</b>, Same as 'B', but in "D" &#8211; "O", amino acids that are identical in all 6 ARV, MRV, and AqRV sequences (see Fig. 1) are shown in darker versions of each motif color (goldenrod, dim grey, blue, red, and green, respectively), amino acids that represent conservative substitutions (as determined by Blossum50 matrix) are shown in lighter versions of each motif color (yellow, medium grey, cyan, hotpink, and light green, respectively), and non-conserved amino acids are shown in white. The canonical GDD motif is depicted in black. <b>D - G</b>, represent successive 90&#176; rotations counter-clockwise around vertical axis, of entire RdRp protein, to correspond to front (as depicted in "A"), left side, back, and right side. <b>H - K</b>, represent same views as "D - G", respectively, but with the front approximate half of each view removed. <b>L </b>and <b>N</b>, represent top and bottom view, respectively, of RdRp molecule. <b>M</b>, represents top view, after upper approximately 40% of view removed, and <b>O</b>, represents bottom view, after lower approximately half of view removed. The top surface depicted in "L" is believed to interact with the &#955;-class core shell protein.</p>
            </text>
            <graphic file="1743-422X-5-153-4"/>
         </fig>
         <p>In conclusion, we report the first sequence analysis of the avian reovirus RdRp gene and protein. The ARV &#955;B and MRV &#955;3 proteins showed the highest ARV:MRV identity values (~55%) amongst currently known ARV and MRV proteins, suggesting significant evolutionary constraints are placed on dsRNA RdRp molecules, particularly in regions comprising the canonical polymerase motifs and residues thought to interact directly with template and nascent mRNA.</p>
      </sec>
      <sec>
         <st>
            <p>Competing interests</p>
         </st>
         <p>The authors declare that they have no competing interests.</p>
      </sec>
      <sec>
         <st>
            <p>Authors' contributions</p>
         </st>
         <p>WX performed the experiments and analyses and WX and KC wrote the manuscript.</p>
      </sec>
   </bdy>
   <bm>
      <ack>
         <sec>
            <st>
               <p>Acknowledgements</p>
            </st>
            <p>We thank members of our laboratory for critical reviews of this manuscript and Kolawole Opanubi for expert technical assistance. This research was supported by grant FRN-11630 from the Canadian Institutes of Health Research.</p>
         </sec>
      </ack>
      <refgrp>
         <bibl id="B1">
            <title>
               <p>The dsRNA viruses</p>
            </title>
            <aug>
               <au>
                  <snm>Mertens</snm>
                  <fnm>P</fnm>
               </au>
            </aug>
            <source>Virus Research</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <fpage>3</fpage>
            <lpage>13</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virusres.2003.12.002</pubid>
                  <pubid idtype="pmpid" link="fulltext">15010213</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B2">
            <title>
               <p>Orthoreoviruses and their replication</p>
            </title>
            <aug>
               <au>
                  <snm>Schiff</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Tyler</snm>
                  <fnm>KL</fnm>
               </au>
            </aug>
            <source>Fields Virology</source>
            <publisher>Philadelphia: Lippincott Williams &amp; Wilkins</publisher>
            <editor>Knipe DM, Howley PM</editor>
            <pubdate>2007</pubdate>
            <fpage>1853</fpage>
            <lpage>1915</lpage>
         </bibl>
         <bibl id="B3">
            <title>
               <p>"Genus Orthoreovirus"</p>
            </title>
            <aug>
               <au>
                  <snm>Chappell</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Duncan</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Mertens</snm>
                  <fnm>PPC</fnm>
               </au>
               <au>
                  <snm>Dermody</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Virus Taxonomy Eighth Report of the International Committee on Taxonomy of Viruses</source>
            <publisher>San Diego, CA: Elsevier Inc</publisher>
            <editor>Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA</editor>
            <pubdate>2005</pubdate>
         </bibl>
         <bibl id="B4">
            <title>
               <p>Reovirus type 1 associated with meningitis</p>
            </title>
            <aug>
               <au>
                  <snm>Johansson</snm>
                  <fnm>PJ</fnm>
               </au>
               <au>
                  <snm>Sveger</snm>
                  <fnm>T</fnm>
               </au>
               <au>
                  <snm>Ahlfors</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Ekstrand</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Svensson</snm>
                  <fnm>L</fnm>
               </au>
            </aug>
            <source>Scand J Infect Dis</source>
            <pubdate>1996</pubdate>
            <volume>28</volume>
            <fpage>117</fpage>
            <lpage>120</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.3109/00365549609049060</pubid>
                  <pubid idtype="pmpid">8792475</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B5">
            <title>
               <p>Reovirus type 2 isolated from cerebrospinal fluid</p>
            </title>
            <aug>
               <au>
                  <snm>Hermann</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Embree</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Hazelton</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Wells</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Coombs</snm>
                  <fnm>K</fnm>
               </au>
            </aug>
            <source>Ped Infect Dis J</source>
            <pubdate>2004</pubdate>
            <volume>23</volume>
            <fpage>373</fpage>
            <lpage>375</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1097/00006454-200404000-00026</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B6">
            <title>
               <p>Isolation and molecular characterization of a novel type 3 reovirus from a child with meningitis</p>
            </title>
            <aug>
               <au>
                  <snm>Tyler</snm>
                  <fnm>KL</fnm>
               </au>
               <au>
                  <snm>Barton</snm>
                  <fnm>ES</fnm>
               </au>
               <au>
                  <snm>Ibach</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Robinson</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Campbell</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>O'Donnell</snm>
                  <fnm>SM</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Infect Dis</source>
            <pubdate>2004</pubdate>
            <volume>189</volume>
            <fpage>1664</fpage>
            <lpage>1675</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1086/383129</pubid>
                  <pubid idtype="pmpid" link="fulltext">15116303</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B7">
            <title>
               <p>Characterization of two reoviruses isolated from turkeys with infectious enteritis</p>
            </title>
            <aug>
               <au>
                  <snm>Gershowitz</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Wooley</snm>
                  <fnm>RW</fnm>
               </au>
            </aug>
            <source>Avian Dis</source>
            <pubdate>1973</pubdate>
            <volume>17</volume>
            <fpage>406</fpage>
            <lpage>414</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.2307/1589225</pubid>
                  <pubid idtype="pmpid">4351419</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B8">
            <title>
               <p>"Reovirus infections"</p>
            </title>
            <aug>
               <au>
                  <snm>Olson</snm>
                  <fnm>NO</fnm>
               </au>
            </aug>
            <source>Diseases of poultry</source>
            <publisher>Ames, Iowa: Iowa State University Press</publisher>
            <editor>Hofstad MS</editor>
            <pubdate>1978</pubdate>
         </bibl>
         <bibl id="B9">
            <title>
               <p>Runting and leg weakness in broilers: involvement of infectious factors</p>
            </title>
            <aug>
               <au>
                  <snm>Kouwenhoven</snm>
                  <fnm>B</fnm>
               </au>
               <au>
                  <snm>Vertommen</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Eck</snm>
                  <fnm>JHv</fnm>
               </au>
            </aug>
            <source>Vet Sci Commun</source>
            <pubdate>1978</pubdate>
            <volume>2</volume>
            <fpage>253</fpage>
            <lpage>259</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1007/BF02291456</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B10">
            <title>
               <p>"Reovirus infections"</p>
            </title>
            <aug>
               <au>
                  <snm>Rosenberger</snm>
                  <fnm>JK</fnm>
               </au>
               <au>
                  <snm>Olson</snm>
                  <fnm>NO</fnm>
               </au>
            </aug>
            <source>Diseases of poultry</source>
            <publisher>Ames, Iowa: Iowa State University Press</publisher>
            <editor>Calnek BW, Burnes MJ, Beard CW, Reid WM, Yoder HW</editor>
            <pubdate>1991</pubdate>
         </bibl>
         <bibl id="B11">
            <title>
               <p>Physical and chemical characterization of an avian reovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Spandidos</snm>
                  <fnm>DA</fnm>
               </au>
               <au>
                  <snm>Graham</snm>
                  <fnm>AF</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1976</pubdate>
            <volume>19</volume>
            <fpage>968</fpage>
            <lpage>976</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">354937</pubid>
                  <pubid idtype="pmpid" link="fulltext">987252</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B12">
            <title>
               <p>Avian reovirus: Structure and biology</p>
            </title>
            <aug>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Virus Research</source>
            <pubdate>2007</pubdate>
            <volume>123</volume>
            <fpage>105</fpage>
            <lpage>119</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virusres.2006.09.005</pubid>
                  <pubid idtype="pmpid" link="fulltext">17018239</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B13">
            <title>
               <p>Polymorphism of the genomic RNAs among the avian reoviruses</p>
            </title>
            <aug>
               <au>
                  <snm>Gouvea</snm>
                  <fnm>VS</fnm>
               </au>
               <au>
                  <snm>Schnitzer</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>J Gen Virol</source>
            <pubdate>1982</pubdate>
            <volume>61</volume>
            <issue>Pt 1</issue>
            <fpage>87</fpage>
            <lpage>91</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1099/0022-1317-61-1-87</pubid>
                  <pubid idtype="pmpid" link="fulltext">7119751</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B14">
            <title>
               <p>The avian reovirus genome segment S1 is a functionally tricistronic gene that expresses one structural and two nonstructural proteins in infected cells</p>
            </title>
            <aug>
               <au>
                  <snm>Bodelon</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Labrada</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2001</pubdate>
            <volume>290</volume>
            <fpage>181</fpage>
            <lpage>191</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.2001.1159</pubid>
                  <pubid idtype="pmpid" link="fulltext">11883183</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B15">
            <title>
               <p>Sequential partially overlapping gene arrangement in the tricistronic S1 genome segments of avian reovirus and Nelson Bay reovirus: implications for translation initiation</p>
            </title>
            <aug>
               <au>
                  <snm>Shmulevitz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Yameen</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>Dawe</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Shou</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>O'Hara</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Holmes</snm>
                  <fnm>I</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Virol</source>
            <pubdate>2002</pubdate>
            <volume>76</volume>
            <fpage>609</fpage>
            <lpage>618</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">136829</pubid>
                  <pubid idtype="pmpid" link="fulltext">11752152</pubid>
                  <pubid idtype="doi">10.1128/JVI.76.2.609-618.2002</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B16">
            <title>
               <p>Protein coding assignment of the S genes of the avian reovirus S1133</p>
            </title>
            <aug>
               <au>
                  <snm>Schnitzer</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1985</pubdate>
            <volume>141</volume>
            <fpage>167</fpage>
            <lpage>170</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(85)90194-1</pubid>
                  <pubid idtype="pmpid">3976177</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B17">
            <title>
               <p>Characterization of avian reovirus-induced cell fusion: the role of viral structural proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Ni</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Ramig</snm>
                  <fnm>RF</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1993</pubdate>
            <volume>194</volume>
            <fpage>705</fpage>
            <lpage>714</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1993.1311</pubid>
                  <pubid idtype="pmpid" link="fulltext">8503184</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B18">
            <title>
               <p>Avian reovirus sigma C protein contains a putative fusion sequence and induces fusion when expressed in mammalian cells</p>
            </title>
            <aug>
               <au>
                  <snm>Theophilos</snm>
                  <fnm>MB</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Holmes</snm>
                  <fnm>IH</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1995</pubdate>
            <volume>208</volume>
            <fpage>678</fpage>
            <lpage>684</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1995.1199</pubid>
                  <pubid idtype="pmpid" link="fulltext">7747439</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B19">
            <title>
               <p>Protein architecture of avian reovirus S1133 and identification of the cell attachment protein</p>
            </title>
            <aug>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Grande</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Varela</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Garcia-Martinez</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1997</pubdate>
            <volume>71</volume>
            <fpage>59</fpage>
            <lpage>64</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">191024</pubid>
                  <pubid idtype="pmpid" link="fulltext">8985323</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B20">
            <title>
               <p>Avian reovirus infections</p>
            </title>
            <aug>
               <au>
                  <snm>Jones</snm>
                  <fnm>RC</fnm>
               </au>
            </aug>
            <source>Rev Sci Tech</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <fpage>614</fpage>
            <lpage>625</lpage>
            <xrefbib>
               <pubid idtype="pmpid">10935283</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B21">
            <title>
               <p>Structure of avian orthoreovirus virion by electron cryomicroscopy and image reconstruction</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Tang</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>O'Hara</snm>
                  <fnm>D</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Duncan</snm>
                  <fnm>R</fnm>
               </au>
               <etal/>
            </aug>
            <source>Virology</source>
            <pubdate>2005</pubdate>
            <volume>343</volume>
            <fpage>25</fpage>
            <lpage>35</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virol.2005.08.002</pubid>
                  <pubid idtype="pmpid" link="fulltext">16153672</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B22">
            <title>
               <p>Interaction of reovirus with cell surface receptors. I. Murine and human lymphocytes have a receptor for the hemagglutinin of reovirus type 3</p>
            </title>
            <aug>
               <au>
                  <snm>Weiner</snm>
                  <fnm>HL</fnm>
               </au>
               <au>
                  <snm>Ault</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Fields</snm>
                  <fnm>BN</fnm>
               </au>
            </aug>
            <source>J Immunol</source>
            <pubdate>1980</pubdate>
            <volume>124</volume>
            <fpage>2143</fpage>
            <lpage>2148</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">7365250</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B23">
            <title>
               <p>Subunit composition and conformational stability of the oligomeric form of the avian reovirus cell-attachment protein sigmaC</p>
            </title>
            <aug>
               <au>
                  <snm>Grande</snm>
                  <fnm>A</fnm>
               </au>
               <au>
                  <snm>Costas</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Gen Virol</source>
            <pubdate>2002</pubdate>
            <volume>83</volume>
            <fpage>131</fpage>
            <lpage>139</lpage>
            <xrefbib>
               <pubid idtype="pmpid" link="fulltext">11752709</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B24">
            <title>
               <p>A new class of fusion-associated small transmembrane (FAST) proteins encoded by the non-enveloped fusogenic reoviruses</p>
            </title>
            <aug>
               <au>
                  <snm>Shmulevitz</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Duncan</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>EMBO J</source>
            <pubdate>2000</pubdate>
            <volume>19</volume>
            <fpage>902</fpage>
            <lpage>912</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">305630</pubid>
                  <pubid idtype="pmpid" link="fulltext">10698932</pubid>
                  <pubid idtype="doi">10.1093/emboj/19.5.902</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B25">
            <title>
               <p>Biosynthesis of reovirus-specified polypeptides. Molecular cDNA cloning and nucleotide sequence of the reovirus serotype 1 Lang strain bicistronic s1 mRNA which encodes the minor capsid polypeptide sigma 1a and the nonstructural polypeptide sigma 1bNS</p>
            </title>
            <aug>
               <au>
                  <snm>Munemitsu</snm>
                  <fnm>SM</fnm>
               </au>
               <au>
                  <snm>Atwater</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Samuel</snm>
                  <fnm>CE</fnm>
               </au>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>1986</pubdate>
            <volume>140</volume>
            <fpage>508</fpage>
            <lpage>514</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0006-291X(86)90761-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">2430568</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B26">
            <title>
               <p>The structure of orthoreoviruses</p>
            </title>
            <aug>
               <au>
                  <snm>Dryden</snm>
                  <fnm>KA</fnm>
               </au>
               <au>
                  <snm>Coombs</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Yeager</snm>
                  <fnm>M</fnm>
               </au>
            </aug>
            <source>Segmented Double-stranded RNA Viruses: Structure and Molecular Biology</source>
            <publisher>Horizon Press</publisher>
            <editor>Patton JT</editor>
            <pubdate>2008</pubdate>
            <fpage>3</fpage>
            <lpage>25</lpage>
         </bibl>
         <bibl id="B27">
            <title>
               <p>Distinct binding sites for zinc and double-stranded RNA in the reovirus outer capsid protein sigma 3</p>
            </title>
            <aug>
               <au>
                  <snm>Schiff</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Co</snm>
                  <fnm>MS</fnm>
               </au>
               <au>
                  <snm>Brown</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Fields</snm>
                  <fnm>BN</fnm>
               </au>
            </aug>
            <source>Mol Cell Biol</source>
            <pubdate>1988</pubdate>
            <volume>8</volume>
            <fpage>273</fpage>
            <lpage>283</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">363116</pubid>
                  <pubid idtype="pmpid" link="fulltext">3275869</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B28">
            <title>
               <p>Evidence that avian reovirus sigmaA protein is an inhibitor of the double-stranded RNA-dependent protein kinase</p>
            </title>
            <aug>
               <au>
                  <snm>Gonzalez-Lopez</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Esteban</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Gen Virol</source>
            <pubdate>2003</pubdate>
            <volume>84</volume>
            <fpage>1629</fpage>
            <lpage>1639</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1099/vir.0.19004-0</pubid>
                  <pubid idtype="pmpid" link="fulltext">12771434</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B29">
            <title>
               <p>Evidence of nucleotidyl phosphatase activity associated with core protein sigma A of avian reovirus S1133</p>
            </title>
            <aug>
               <au>
                  <snm>Yin</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Su</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>LH</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2002</pubdate>
            <volume>293</volume>
            <fpage>379</fpage>
            <lpage>385</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.2001.1292</pubid>
                  <pubid idtype="pmpid" link="fulltext">11886258</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B30">
            <title>
               <p>Core protein mu2 is a second determinant of nucleoside triphosphatase activities by reovirus cores</p>
            </title>
            <aug>
               <au>
                  <snm>Noble</snm>
                  <fnm>S</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>J Virol</source>
            <pubdate>1997</pubdate>
            <volume>71</volume>
            <fpage>7728</fpage>
            <lpage>7735</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">192124</pubid>
                  <pubid idtype="pmpid" link="fulltext">9311857</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B31">
            <title>
               <p>Characterization of the nucleoside triphosphate phosphohydrolase and helicase activities of the reovirus lambda1 protein</p>
            </title>
            <aug>
               <au>
                  <snm>Bisaillon</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Bergeron</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Lemay</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>J Biol Chem</source>
            <pubdate>1997</pubdate>
            <volume>272</volume>
            <fpage>18298</fpage>
            <lpage>18303</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1074/jbc.272.29.18298</pubid>
                  <pubid idtype="pmpid" link="fulltext">9218469</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B32">
            <title>
               <p>The sequences of reovirus serotype 3 genome segments M1 and M3 encoding the minor protein mu 2 and the major nonstructural protein mu NS, respectively</p>
            </title>
            <aug>
               <au>
                  <snm>Wiener</snm>
                  <fnm>JR</fnm>
               </au>
               <au>
                  <snm>Bartlett</snm>
                  <fnm>JA</fnm>
               </au>
               <au>
                  <snm>Joklik</snm>
                  <fnm>WK</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1989</pubdate>
            <volume>169</volume>
            <fpage>293</fpage>
            <lpage>304</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/0042-6822(89)90154-2</pubid>
                  <pubid idtype="pmpid">2523177</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B33">
            <title>
               <p>Mammalian reovirus L2 gene and lambda2 core spike protein sequences and whole-genome comparisons of reoviruses type 1 Lang, type 2 Jones, and type 3 Dearing</p>
            </title>
            <aug>
               <au>
                  <snm>Breun</snm>
                  <fnm>LA</fnm>
               </au>
               <au>
                  <snm>Broering</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>McCutcheon</snm>
                  <fnm>AM</fnm>
               </au>
               <au>
                  <snm>Harrison</snm>
                  <fnm>SJ</fnm>
               </au>
               <au>
                  <snm>Luongo</snm>
                  <fnm>CL</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2001</pubdate>
            <volume>287</volume>
            <fpage>333</fpage>
            <lpage>348</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.2001.1052</pubid>
                  <pubid idtype="pmpid" link="fulltext">11531411</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B34">
            <title>
               <p>Comparisons of the M1 genome segments and encoded &#956;2 proteins of different reovirus isolates</p>
            </title>
            <aug>
               <au>
                  <snm>Yin</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Keirstead</snm>
                  <fnm>ND</fnm>
               </au>
               <au>
                  <snm>Broering</snm>
                  <fnm>TJ</fnm>
               </au>
               <au>
                  <snm>Arnold</snm>
                  <fnm>MM</fnm>
               </au>
               <au>
                  <snm>Parker</snm>
                  <fnm>JSL</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
               <etal/>
            </aug>
            <source>Virol J</source>
            <volume>1</volume>
            <issue>6</issue>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">524354</pubid>
                  <pubid idtype="pmpid" link="fulltext">15507160</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B35">
            <title>
               <p>Cloning and nucleotide sequencing of the S4 genome segment of avian reovirus S1133</p>
            </title>
            <aug>
               <au>
                  <snm>Chiu</snm>
                  <fnm>CJ</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>LH</fnm>
               </au>
            </aug>
            <source>Arch Virol</source>
            <pubdate>1997</pubdate>
            <volume>142</volume>
            <fpage>2515</fpage>
            <lpage>2520</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1007/s007050050258</pubid>
                  <pubid idtype="pmpid" link="fulltext">9672610</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B36">
            <title>
               <p>Extensive sequence divergence and phylogenetic relationships between the fusogenic and nonfusogenic orthoreoviruses: a species proposal</p>
            </title>
            <aug>
               <au>
                  <snm>Duncan</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1999</pubdate>
            <volume>260</volume>
            <fpage>316</fpage>
            <lpage>328</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1999.9832</pubid>
                  <pubid idtype="pmpid" link="fulltext">10417266</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B37">
            <title>
               <p>Sequence and phylogenetic analysis of the sigma A-encoding gene of avian reovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Liu</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>PH</fnm>
               </au>
            </aug>
            <source>J Virol Meth</source>
            <pubdate>2001</pubdate>
            <volume>98</volume>
            <fpage>99</fpage>
            <lpage>107</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1016/S0166-0934(01)00328-7</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B38">
            <title>
               <p>Sequence analysis of the S3 gene from a turkey reovirus</p>
            </title>
            <aug>
               <au>
                  <snm>Kapczynski</snm>
                  <fnm>DR</fnm>
               </au>
               <au>
                  <snm>Sellers</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Simmons</snm>
                  <fnm>V</fnm>
               </au>
               <au>
                  <snm>Schultz-Cherry</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Virus Genes</source>
            <pubdate>2002</pubdate>
            <volume>25</volume>
            <fpage>95</fpage>
            <lpage>100</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1020130410601</pubid>
                  <pubid idtype="pmpid" link="fulltext">12206313</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B39">
            <title>
               <p>Phylogenetic analysis of the sigma 2 protein gene of turkey reoviruses</p>
            </title>
            <aug>
               <au>
                  <snm>Sellers</snm>
                  <fnm>HS</fnm>
               </au>
               <au>
                  <snm>Linnemann</snm>
                  <fnm>EG</fnm>
               </au>
               <au>
                  <snm>Pereira</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Kapczynski</snm>
                  <fnm>DR</fnm>
               </au>
            </aug>
            <source>Avian Dis</source>
            <pubdate>2004</pubdate>
            <volume>48</volume>
            <fpage>651</fpage>
            <lpage>657</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1637/7181-032304R</pubid>
                  <pubid idtype="pmpid">15529990</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B40">
            <title>
               <p>Avian reovirus morphogenesis occurs within viral factories and begins with the selective recruitment of sigma NS and lambda A to mu NS inclusions</p>
            </title>
            <aug>
               <au>
                  <snm>Touris-Otero</snm>
                  <fnm>F</fnm>
               </au>
               <au>
                  <snm>Cortez-San Mart&#237;n</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2004</pubdate>
            <volume>341</volume>
            <fpage>361</fpage>
            <lpage>374</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.jmb.2004.06.026</pubid>
                  <pubid idtype="pmpid" link="fulltext">15276829</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B41">
            <title>
               <p>Sequences of avian reovirus M1, M2 and M3 genes and predicted structure/function of the encoded mu proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Noad</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Shou</snm>
                  <fnm>JY</fnm>
               </au>
               <au>
                  <snm>Coombs</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Duncan</snm>
                  <fnm>R</fnm>
               </au>
            </aug>
            <source>Virus Research</source>
            <pubdate>2006</pubdate>
            <volume>116</volume>
            <fpage>45</fpage>
            <lpage>57</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virusres.2005.08.014</pubid>
                  <pubid idtype="pmpid" link="fulltext">16297481</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B42">
            <title>
               <p>Cloning, expression, and characterization of avian reovirus guanylyltransferase</p>
            </title>
            <aug>
               <au>
                  <snm>Hsiao</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Benavente</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Vakharia</snm>
                  <fnm>VN</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2002</pubdate>
            <volume>296</volume>
            <fpage>288</fpage>
            <lpage>299</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.2002.1427</pubid>
                  <pubid idtype="pmpid" link="fulltext">12069527</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B43">
            <title>
               <p>Genetic variation of the lambda A and lambda C protein encoding genes of avian reoviruses</p>
            </title>
            <aug>
               <au>
                  <snm>Shen</snm>
                  <fnm>PC</fnm>
               </au>
               <au>
                  <snm>Chiou</snm>
                  <fnm>YF</fnm>
               </au>
               <au>
                  <snm>Liu</snm>
                  <fnm>HJ</fnm>
               </au>
               <au>
                  <snm>Song</snm>
                  <fnm>CH</fnm>
               </au>
               <au>
                  <snm>Su</snm>
                  <fnm>YP</fnm>
               </au>
               <au>
                  <snm>Lee</snm>
                  <fnm>LH</fnm>
               </au>
            </aug>
            <source>Res Vet Sci</source>
            <pubdate>2007</pubdate>
            <volume>83</volume>
            <fpage>394</fpage>
            <lpage>402</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.rvsc.2007.01.002</pubid>
                  <pubid idtype="pmpid" link="fulltext">17336355</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B44">
            <title>
               <p>Generation and genetic characterization of avian reovirus temperature-sensitive mutants</p>
            </title>
            <aug>
               <au>
                  <snm>Patrick</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Duncan</snm>
                  <fnm>R</fnm>
               </au>
               <au>
                  <snm>Coombs</snm>
                  <fnm>KM</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>2001</pubdate>
            <volume>284</volume>
            <fpage>113</fpage>
            <lpage>122</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.2001.0915</pubid>
                  <pubid idtype="pmpid" link="fulltext">11352672</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B45">
            <aug>
               <au>
                  <snm>Sambrook</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Fritsch</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Maniatis</snm>
                  <fnm>T</fnm>
               </au>
            </aug>
            <source>Molecular cloning: a laboratory manual</source>
            <publisher>Cold Spring Harbor: Cold Spring Harbor Laboratory</publisher>
            <edition>2</edition>
            <pubdate>1989</pubdate>
         </bibl>
         <bibl id="B46">
            <title>
               <p>Rapid Similarity Searches of Nucleic-Acid and Protein Data Banks</p>
            </title>
            <aug>
               <au>
                  <snm>Wilbur</snm>
                  <fnm>WJ</fnm>
               </au>
               <au>
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
            </aug>
            <source>Proc Natl Acad Sci (USA)</source>
            <pubdate>1983</pubdate>
            <volume>80</volume>
            <fpage>726</fpage>
            <lpage>730</lpage>
            <xrefbib>
               <pubid idtype="doi">10.1073/pnas.80.3.726</pubid>
            </xrefbib>
         </bibl>
         <bibl id="B47">
            <title>
               <p>An Efficient Method for Finding Repeats in Molecular Sequences</p>
            </title>
            <aug>
               <au>
                  <snm>Martinez</snm>
                  <fnm>HM</fnm>
               </au>
            </aug>
            <source>Nucl Acids Res</source>
            <pubdate>1983</pubdate>
            <volume>11</volume>
            <fpage>4629</fpage>
            <lpage>4634</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">326069</pubid>
                  <pubid idtype="pmpid" link="fulltext">6866775</pubid>
                  <pubid idtype="doi">10.1093/nar/11.13.4629</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B48">
            <title>
               <p>Rapid and Sensitive Protein Similarity Searches</p>
            </title>
            <aug>
               <au>
                  <snm>Lipman</snm>
                  <fnm>DJ</fnm>
               </au>
               <au>
                  <snm>Pearson</snm>
                  <fnm>WR</fnm>
               </au>
            </aug>
            <source>Science</source>
            <pubdate>1985</pubdate>
            <volume>227</volume>
            <fpage>1435</fpage>
            <lpage>1441</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1126/science.2983426</pubid>
                  <pubid idtype="pmpid" link="fulltext">2983426</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B49">
            <title>
               <p>CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice</p>
            </title>
            <aug>
               <au>
                  <snm>Thompson</snm>
                  <fnm>JD</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Gibson</snm>
                  <fnm>TJ</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1994</pubdate>
            <volume>22</volume>
            <fpage>4673</fpage>
            <lpage>4680</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">308517</pubid>
                  <pubid idtype="pmpid" link="fulltext">7984417</pubid>
                  <pubid idtype="doi">10.1093/nar/22.22.4673</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B50">
            <title>
               <p>T-Coffee: A novel method for fast and accurate multiple sequence alignment</p>
            </title>
            <aug>
               <au>
                  <snm>Notredame</snm>
                  <fnm>C</fnm>
               </au>
               <au>
                  <snm>Higgins</snm>
                  <fnm>DG</fnm>
               </au>
               <au>
                  <snm>Heringa</snm>
                  <fnm>J</fnm>
               </au>
            </aug>
            <source>J Mol Biol</source>
            <pubdate>2000</pubdate>
            <volume>302</volume>
            <fpage>205</fpage>
            <lpage>217</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/jmbi.2000.4042</pubid>
                  <pubid idtype="pmpid" link="fulltext">10964570</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B51">
            <title>
               <p>MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0</p>
            </title>
            <aug>
               <au>
                  <snm>Tamura</snm>
                  <fnm>K</fnm>
               </au>
               <au>
                  <snm>Dudley</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Nei</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Kumar</snm>
                  <fnm>S</fnm>
               </au>
            </aug>
            <source>Mol Biol Evol</source>
            <pubdate>2007</pubdate>
            <volume>24</volume>
            <fpage>1596</fpage>
            <lpage>1599</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1093/molbev/msm092</pubid>
                  <pubid idtype="pmpid" link="fulltext">17488738</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B52">
            <title>
               <p>RNA synthesis in a cage &#8211; Structural studies of reovirus polymerase lambda3</p>
            </title>
            <aug>
               <au>
                  <snm>Tao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Farsetta</snm>
                  <fnm>DL</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Harrison</snm>
                  <fnm>SC</fnm>
               </au>
            </aug>
            <source>Cell</source>
            <pubdate>2002</pubdate>
            <volume>111</volume>
            <fpage>733</fpage>
            <lpage>745</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/S0092-8674(02)01110-8</pubid>
                  <pubid idtype="pmpid" link="fulltext">12464184</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B53">
            <title>
               <p>UCSF chimera &#8211; A visualization system for exploratory research and analysis</p>
            </title>
            <aug>
               <au>
                  <snm>Pettersen</snm>
                  <fnm>EF</fnm>
               </au>
               <au>
                  <snm>Goddard</snm>
                  <fnm>TD</fnm>
               </au>
               <au>
                  <snm>Huang</snm>
                  <fnm>CC</fnm>
               </au>
               <au>
                  <snm>Couch</snm>
                  <fnm>GS</fnm>
               </au>
               <au>
                  <snm>Greenblatt</snm>
                  <fnm>DM</fnm>
               </au>
               <au>
                  <snm>Meng</snm>
                  <fnm>EC</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Comput Chem</source>
            <pubdate>2004</pubdate>
            <volume>25</volume>
            <fpage>1605</fpage>
            <lpage>1612</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1002/jcc.20084</pubid>
                  <pubid idtype="pmpid" link="fulltext">15264254</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B54">
            <title>
               <p>Reovirus protein lambda 3 is a poly(C)-dependent poly(G) polymerase</p>
            </title>
            <aug>
               <au>
                  <snm>Starnes</snm>
                  <fnm>MC</fnm>
               </au>
               <au>
                  <snm>Joklik</snm>
                  <fnm>WK</fnm>
               </au>
            </aug>
            <source>Virology</source>
            <pubdate>1993</pubdate>
            <volume>193</volume>
            <fpage>356</fpage>
            <lpage>366</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/viro.1993.1132</pubid>
                  <pubid idtype="pmpid" link="fulltext">8438576</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B55">
            <title>
               <p>Sequence of genome segments 1, 2, and 3 of the grass carp reovirus (Genus Aquareovirus, family Reoviridae)</p>
            </title>
            <aug>
               <au>
                  <snm>Fang</snm>
                  <fnm>Q</fnm>
               </au>
               <au>
                  <snm>Attoui</snm>
                  <fnm>H</fnm>
               </au>
               <au>
                  <snm>Cantaloube</snm>
                  <fnm>JF</fnm>
               </au>
               <au>
                  <snm>Biagini</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Zhu</snm>
                  <fnm>Z</fnm>
               </au>
               <au>
                  <snm>de Micco</snm>
                  <fnm>P</fnm>
               </au>
               <etal/>
            </aug>
            <source>Biochem Biophys Res Commun</source>
            <pubdate>2000</pubdate>
            <volume>274</volume>
            <fpage>762</fpage>
            <lpage>766</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1006/bbrc.2000.3215</pubid>
                  <pubid idtype="pmpid" link="fulltext">10924351</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B56">
            <title>
               <p>Computational sequence analysis of mammalian reovirus proteins</p>
            </title>
            <aug>
               <au>
                  <snm>Bisaillon</snm>
                  <fnm>M</fnm>
               </au>
               <au>
                  <snm>Lemay</snm>
                  <fnm>G</fnm>
               </au>
            </aug>
            <source>Virus Genes</source>
            <pubdate>1999</pubdate>
            <volume>18</volume>
            <fpage>13</fpage>
            <lpage>37</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1023/A:1008013117929</pubid>
                  <pubid idtype="pmpid" link="fulltext">10334035</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B57">
            <title>
               <p>A possible relationship of reovirus putative RNA polymerase to polymerases of positive-strand RNA viruses</p>
            </title>
            <aug>
               <au>
                  <snm>Morozov</snm>
                  <fnm>SY</fnm>
               </au>
            </aug>
            <source>Nucleic Acids Res</source>
            <pubdate>1989</pubdate>
            <volume>17</volume>
            <fpage>5394</fpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">318133</pubid>
                  <pubid idtype="pmpid" link="fulltext">2548159</pubid>
                  <pubid idtype="doi">10.1093/nar/17.13.5394</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B58">
            <title>
               <p>Relationships Among the Positive Strand and Double-Strand Rna Viruses As Viewed Through Their Rna-Dependent Rna-Polymerases</p>
            </title>
            <aug>
               <au>
                  <snm>Bruenn</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Nucl Acids Res</source>
            <pubdate>1991</pubdate>
            <volume>19</volume>
            <fpage>217</fpage>
            <lpage>226</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">333583</pubid>
                  <pubid idtype="pmpid" link="fulltext">2014162</pubid>
                  <pubid idtype="doi">10.1093/nar/19.2.217</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B59">
            <title>
               <p>A structural and primary sequence comparison of the viral RNA-dependent RNA polymerases</p>
            </title>
            <aug>
               <au>
                  <snm>Bruenn</snm>
                  <fnm>JA</fnm>
               </au>
            </aug>
            <source>Nucl Acids Res</source>
            <pubdate>2003</pubdate>
            <volume>31</volume>
            <fpage>1821</fpage>
            <lpage>1829</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="pmcid">152793</pubid>
                  <pubid idtype="pmpid" link="fulltext">12654997</pubid>
                  <pubid idtype="doi">10.1093/nar/gkg277</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B60">
            <title>
               <p>Orthoreovirus and Aquareovirus core proteins: conserved enzymatic surfaces, but not protein-protein interfaces</p>
            </title>
            <aug>
               <au>
                  <snm>Kim</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Tao</snm>
                  <fnm>Y</fnm>
               </au>
               <au>
                  <snm>Reinisch</snm>
                  <fnm>KM</fnm>
               </au>
               <au>
                  <snm>Harrison</snm>
                  <fnm>SC</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
            </aug>
            <source>Virus Research</source>
            <pubdate>2004</pubdate>
            <volume>101</volume>
            <fpage>15</fpage>
            <lpage>28</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1016/j.virusres.2003.12.003</pubid>
                  <pubid idtype="pmpid" link="fulltext">15010214</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B61">
            <title>
               <p>Crystal structure of the avian reovirus inner capsid protein sigmaA</p>
            </title>
            <aug>
               <au>
                  <snm>Guardado-Calvo</snm>
                  <fnm>P</fnm>
               </au>
               <au>
                  <snm>Vazquez-Iglesias</snm>
                  <fnm>L</fnm>
               </au>
               <au>
                  <snm>Martinez-Costas</snm>
                  <fnm>J</fnm>
               </au>
               <au>
                  <snm>Llamas-Saiz</snm>
                  <fnm>AL</fnm>
               </au>
               <au>
                  <snm>Schoehn</snm>
                  <fnm>G</fnm>
               </au>
               <au>
                  <snm>Fox</snm>
                  <fnm>GC</fnm>
               </au>
               <etal/>
            </aug>
            <source>J Virol</source>
            <pubdate>2008</pubdate>
            <volume>82</volume>
            <fpage>11208</fpage>
            <lpage>11216</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1128/JVI.00733-08</pubid>
                  <pubid idtype="pmpid" link="fulltext">18799570</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
         <bibl id="B62">
            <title>
               <p>Reovirus polymerase lambda 3 localized by cryo-electron microscopy of virions at a resolution of 7.6 angstrom</p>
            </title>
            <aug>
               <au>
                  <snm>Zhang</snm>
                  <fnm>X</fnm>
               </au>
               <au>
                  <snm>Walker</snm>
                  <fnm>SB</fnm>
               </au>
               <au>
                  <snm>Chipman</snm>
                  <fnm>PR</fnm>
               </au>
               <au>
                  <snm>Nibert</snm>
                  <fnm>ML</fnm>
               </au>
               <au>
                  <snm>Baker</snm>
                  <fnm>TS</fnm>
               </au>
            </aug>
            <source>Nature Structural Biology</source>
            <pubdate>2003</pubdate>
            <volume>10</volume>
            <fpage>1011</fpage>
            <lpage>1018</lpage>
            <xrefbib>
               <pubidlist>
                  <pubid idtype="doi">10.1038/nsb1009</pubid>
                  <pubid idtype="pmpid" link="fulltext">14608373</pubid>
               </pubidlist>
            </xrefbib>
         </bibl>
      </refgrp>
   </bm>
</art>
