We first sought to develop a NiV VLP expression system using the MVA poxvirus as a means of gene delivery and expression. Here, the NiV N, M, F and G ORFs were sub-cloned into the pMC03-based vector 54 in which the vaccinia virus early-late promoter was replaced with the bacteriophage T7 promoter. These constructs were then used to create the various rMVAs containing the individual NiV genes under the control of the T7 promoter. To test for NiV protein expression, Vero cells were infected with individual rMVAs expressing N, M, F, or G, along with MVAGKT7 encoding the T7 RNA polymerase. Infected cells were metabolically labeled overnight. Cell lysates were prepared and the NiV proteins were immunoprecipitated with NiV-specific polyclonal rabbit serum or rabbit anti-F polyclonal serum (Fig. 1). Immunoprecipitated proteins revealed bands corresponding to NiV N and M (Fig. 1A, lanes 2 and 3) which migrated at the expected apparent molecular weights of ~58 kDa (N) and ~42 kDa (M) respectively 5556. The NiV F₀ (~61 kDa), F₁ (~49 kDa), and G (~74 kDa) shown in Fig 1A (lanes 5 and 7), were found to be consistent with patterns reported previously 25.

In subsequent experiments to evaluate whether expression of NiV proteins can lead to VLP formation, cells were infected with rMVAs and metabolically labeled for 44 h followed by collection of both the cells and culture supernatant. Vesicles in the culture supernatant were pelleted by centrifugation through a 10% sucrose cushion and then floated by centrifugation in a discontinuous sucrose gradient as described in the Methods. Membrane-associated proteins were collected from the top of the gradient and detected by immunoprecipitation and separation by SDS-PAGE followed by autoradiography. While little membrane-associated N was detected in culture supernatants, individual expression of M, F, and G resulted in detectable membrane-associated protein release (Fig. 1B). To characterize the protein release as genuine VLPs, the culture supernatant of metabolically labeled cells expressing N, M, F, and G together was layered onto a 5–45% sucrose gradient, which was then centrifuged to allow membrane-associated proteins to migrate to their buoyant density. Fractions of the gradient were then removed with a portion of each fraction set aside for sucrose density determination. The proteins in the remaining portion of the fractions were then detected by immunoprecipitation followed by SDS-PAGE and autoradiography analysis. NiV proteins were found predominantly in fractions 2 through 4, which corresponded to a density range of 1.12–1.19 g/ml (Fig. 1C). This density range was consistent with the density reported for SeV and NDV VLPs 353638, as well as authentic NiV (see below). To examine the contribution of each viral protein to overall protein release, NiV proteins were expressed in different combinations and their release was quantified. A release of N was not detected when expressed alone, however co-expression of M with N resulted in release of both proteins into the supernatant (Fig. 2A). Quantified expression of M with other viral proteins resulted in a reduction in the mean M released (~12%) compared to its expression alone; however this reduction did not reach statistical significance among repeated experiments (Fig. 2B). We also confirmed that expression of multiple proteins simultaneously did not reduce the overall N, M, F, or G expression levels (data not shown). Quantitation of envelope glycoprotein release revealed that approximately 11% of F and 5% of G was released when expressed alone (Fig. 2C).

Although less cytopathic than its wild-type parent, MVA retains the ability to block host protein synthesis and otherwise interfere with normal cellular metabolism 57. In order to determine whether the protein release we observed was an accurate reflection of NiV biology rather than a potential artifact resulting from poxvirus infection, we employed a transfection plasmid-based expression system using the pCAGGS eukaryotic expression vector, which has also been used in other paramyxovirus VLP assays 3536373850. The NiV N, M, F, and G genes were sub-cloned into the pCAGGS vector and expression was verified in separate experiments by immunoprecipitation (data not shown).

To determine whether the various NiV proteins produced by this method were also released from expressing cells, cultures were transfected with individual plasmid constructs for 24 h, followed by metabolic labeling for another 20 h. Cells and culture supernatants were harvested and processed as described above and in the Methods. We again observed membrane-associated release of M, F and G, but no detectable release of N as predicted (Fig. 3A). Immunoprecipitation analysis of M expressed by plasmid-transfected cells consistently revealed a doublet of bands that were both released into the culture supernatant (Fig. 3A). When M was expressed by MVA, the doublet was usually only revealed by Western Blot (data not shown). We have been unable to determine the nature of the doublet, but it could reflect a post-translational modification of M. Although NiV M does contain a second potential AUG start codon 36 nt downstream of the first start codon 58, this does not account for the doublet appearance because a truncation mutant that begins at the second start codon, as well as HeV M, which lacks the second AUG codon, also appear as doublets (data not shown). Quantification of protein release revealed an overall reduction in protein release compared to that seen in the MVA system (Fig. 3B, compare with Fig. 2). Several studies have provided evidence for a physical interaction between paramyxovirus attachment and fusion proteins 596061. For NiV F and G this interaction is apparent from their ability to be co-precipitated without cross-linking (Bossart and Broder, unpublished data). We therefore sought to determine the effect of F and G co-expression on their release. Expression of F and G together resulted in greater release of both proteins together in comparison to expression of each protein individually (Fig. 3C). This observed increase of their release did not appear to be a result of increased protein expression or cell-surface expression (data not shown). We also noted that when N, M, F and G were all co-expressed using equivalent amounts of transfected plasmids, there was an overall reduction in protein release from cells (data not shown). Indeed, in certain other recombinant VLP expression systems, the amounts of transfected plasmids have been adjusted in order to more accurately reflect or achieve cellular expression levels of the individual viral proteins produced using infectious virus 363850. In an attempt to increase protein release in our system, we performed similar experimental variations in the amounts of tranfected plasmids and estimated envelope glycoprotein expression in authentic NiV infection as one third of M expression and adjusted plasmid ratios accordingly 556263, and we further reduced N expression to 50 ng per well. However, even when the adjusted plasmid ratio was used, overall protein release remained low (Fig. 3D). We verified that this was not due to a reduction of protein expression due to multiple gene expression (data not shown), so we interpret this as indicative of a more organized assembly and budding process. In addition, the co-expression of N and M resulted in the release of N but with modest release of both proteins (Fig. 3E). This was in agreement with our previous results obtained using the MVA expression system, which demonstrated that M facilitated the release of N. However, in contrast to the MVA expression system, here we observed that N reduced overall M release. (Fig. 3E, compare with Fig. 2A and 2B).

In order to ensure that NiV M release was accomplished by a mechanism specific to itself, release of NiV M was again examined but in parallel with SV5 M, which requires co-expression of N and one of the envelope glycoproteins in order to form VLPs that are released into the culture supernatant 50. Here the analysis of culture supernatants showed release of NiV M but no detectable release of SV5 M (Fig. 4A), suggesting that the observed release of NiV M was specific to its biological properties and not due to a non-specific mechanism such as cell lysis. In this respect, NiV M was similar to the M proteins of SeV, NDV, and hPIV1, all of which have been reported to form VLPs in the absence of other viral proteins 35363738.

We also wanted to explore the kinetics of M expression and its eventual release from cells. For this analysis, plasmid-transfected cells were starved for 45 min, ³⁵S-pulsed for 15 min, and then chased for varying lengths of time up to 32 h. At each time point cells and supernatants were harvested. Vesicles released into the supernatant were purified by centrifugation through a 10% sucrose cushion followed by sucrose gradient flotation. M derived from supernatants or cell lysates was immunoprecipitated with a monoclonal antibody and visualized by SDS-PAGE and autoradiography. Percent M release was quantitated by densitometry. The presence of membrane-associated protein in the supernatant was barely detectable at 2 h with 0.3% release, but then readily detected at 4 h with 1.7% release (Fig. 4B). Maximum M release of 27.4% was observed by 16 h.

The biochemical analysis of the NiV proteins released from expressing cells in a membrane-associated manner suggested that VLPs were being generated. To analyze the released material visually, VLPs were prepared and isolated by sucrose gradient floatation and the resulting fractions were immunolabeled using antibodies against NiV M or HeV G followed by a secondary antibody conjugated to gold beads. After negative staining, the samples were examined by immunoelectron microscopy. Expression of NiV M alone resulted in the release of VLPs that contained M and varied in size from approximately 100 to 700 nm in diameter (Fig. 5A–C). Expression of NiV N, M, F, and G resulted in the release of VLPs with detectable M (Fig. 5D) or G (Fig. 5E) with a diameter of approximately 100 to 300 nm. The size of the VLPs observed is consistent with observations made on authentic NiV virions which have been reported with sizes ranging from 40 to 1900 nm 6465.

In order to further investigate the interaction of F and G with M during VLP release we performed sucrose density gradient analyses to determine whether the buoyant density of released particles varied depending on the viral proteins present. M produced alone, F produced with G, or the combination of N, M, F and G were expressed in cells, metabolically labeled, and the culture supernatants were harvested and layered onto 5–45% continuous sucrose gradients. After centrifugation, the gradients were fractionated and analyzed by immunoprecipitation and SDS-PAGE. The M protein was again recovered predominantly in fractions 3 to 5, corresponding to a density range of 1.11–1.18 g/ml (Fig. 6A and 6B). We noted that the M protein could also be found in less dense fractions, especially when it was expressed in the absence of any other viral proteins. When F was co-expressed along with G, both proteins were recovered predominantly in fractions 1 to 3, which correspond to a density of 1.18–1.21 g/ml (Fig. 6A and 6B). However, the co-expression of N, M, F, and G led to a greater concentration of M in fraction 4 and, importantly, this also resulted in a shift of the fractionation profile of F and G distribution to fractions 3 to 5 (Fig. 6A and 6B). This density range was also consistent with the previous results obtained using rMVAs (Fig. 1C). Further, sucrose density gradient analysis of authentic infectious NiV revealed peak virus concentration at a density of 1.15 g/ml, which corresponded well with our VLP results (Fig. 6C). Taken together these findings suggest that although F and G can direct budding when produced alone, the co-expression of M facilitates F and G incorporation into VLPs with a density that is more consistent with that of an authentic virion.

Vero cells, provided by Alison O'Brien (Uniformed Services University), and chicken embryo fibroblast cells (Charles River Laboratories, Inc, Wilmington, MA) were maintained in Eagle's minimal essential medium (Quality Biologicals, Gaithersburg, MD) supplemented with 10% cosmic calf serum (Hyclone, Logan, UT), 2 mM L-glutamine, and 100 units/ml penicillin and streptomycin (Quality Biologicals, Gaithersburg, MD) (EMEM-10). 293T cells were maintained in Dulbecco's modified Eagle's medium (Quality Biologicals, Gaithersburg, MD) supplemented as described above (DMEM-10). All cultures were maintained at 37°C in 7.5% CO₂.

The following antibodies were used in immunoprecipitations: Polyclonal rabbit antiserum against NiV F was obtained by immunization of rabbits with a synthetic peptide of the following sequence: CNTYSRLEDRRVRPTSSGDL, which corresponds to the cytoplasmic tail of NiV F. The peptide was conjugated to keyhole limpet hemocyanin (KLH) for immunization. Monoclonal antibodies (MAbs) F45G5 (anti-M) and F45G6 (anti-N) were kindly provided by Jody Berry and Hana Weingartl (National Centre for Foreign Animal Disease, Canadian Food Inspection Agency). MAb M-h (anti-SV5 M) was kindly provided by Robert Lamb (Northwestern University). Mouse antiserum specific for HeV G was provided by Andrew Hickey (Uniformed Services University). Polyclonal serum from a rabbit immunized with gamma-irradiated NiV and from a rabbit immunized with soluble HeV G were also used.

A system for recombinant gene expression using modified vaccinia virus Ankara (MVA) has been described 54. pMC03ΔE/L, which was made by removing the vaccinia virus promoter from pMC03 by ligation of the vector after PstI digestion, was provided by Katharine Bossart (CSIRO Livestock Industries, Australian Animal Health Laboratory). To introduce the bacteriophage T7 promoter into the vector, complementary oligonucleotides 5'-ggaaattaatacgactcactatagggagaccacaacggtttaaacggcgcgccgga (T7S) and 5'-gatctccggcgcgccgtttaaaccgttgtggtctccctatagtgagtcgtattaatttcctgca (T7AS) were mixed in equal molar amounts, heated to 65°C, then allowed to cool and ligated into the PstI and BglII sites of pMC03ΔE/L to form pMC03T7.

The NiV N ORF was PCR amplified from pCP629 (NiV N gene in pFastBac HTc) using primers 5'-GTTTAAACCACCATGAGTGATATCTTTG (NIVNS) and 5'-GTTTAAACTCACACATCAGCTCTG (NIVNAS). The NiV M ORF was PCR amplified from pCP630 (NiV M gene in pFastBac HTa) using primers 5'-GTTTAAACCACCATGGAGCCGGACATC (NIVMS) and 5'-GTTTAAACTTAGCCCTTTAGAATTCTC (NIVMAS). The NiV F ORF was PCR amplified from pMC02 NiV F 25 using the primers 5'-GTTTAAACCACCATGGTAGTTATACTTGAC (NF2) and 5'-GGCGCGCCCTATGTCCCAATGTAGTAG (NFAS2). The NiV G ORF was PCR amplified from pMC02 NiV G 25 using the primers 5'-GTTTAAACCACCATGCCGGCAGAAAAC (NIVGS) and 5'-GTTTAAACTTATGTACATTGCTCTGG (NIVGAS). PCR was done using Accupol DNA polymerase (PGS Scientifics Corp., Gaithersburg, MD) with the following settings: 94°C for 5 min, then 25 cycles of 94°C for 1 min, 55°C for 2 min, then 72°C for 3 min. The resulting PCR products were sub-cloned into pCRII-Blunt-TOPO (Invitrogen, Carlsbad, CA). TOPO constructs were digested with PmeI or PmeI and AscI, as appropriate, and inserted into PmeI or PmeI-AscI sites in pMC03T7.

The pCAGGS/MCS eukaryotic expression vector has been described previously 7273. In order to introduce an AscI site into pCAGGS, 128 pmol of the oligonucleotide 5'-TCGACGGCGCGCCG (CAG1) was heated to 65°C, allowed to cool, and then ligated into the XhoI site of pCAGGS/MCS to form pCAGGS-AscI. The ORFs for NiV N, M, and G, were digested from pMC03T7 as PmeI fragments and ligated into the pCAGGS SmaI site. The ORF for NiV F was digested from pMC03T7 as a PmeI-AscI fragment and ligated into the pCAGGS-AscI SmaI-AscI site. pCAGGS-SV5 M was kindly provided by Robert Lamb.

To create recombinant MVAs, chicken embryo fibroblasts (CEFs) were infected with wild-type MVA at a multiplicity of infection (MOI) of 0.1. At 2 h post-infection, the CEFs were transfected with 8 μg of the appropriate pMC03T7 construct using Profection Mammalian Transfection System – Calcium Phosphate (Promega, Madison, WI). At 4 hr post-transfection, cells were washed, given fresh EMEM-10, and then incubated for 3 days at 37°C. Cells were harvested by scraping, pelleted, and then resuspended in 0.5 ml EMEM-2.5 as crude recombinant virus. After 3 cycles of freezing and thawing, virus was diluted and CEF monolayers were infected overnight at 37°C. Monolayers were then overlaid with EMEM-10 containing 1% low-melting point agarose (Invitrogen, Gaithersburg, MD) and incubated for 2 days. A final overlay of EMEM-10 containing 1% low-melting point agarose and 0.2 mg/ml 5-bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc) (Clontech, Palo Alto, CA) was added to the monolayers and over the following 72 h cells that showed blue staining were picked, resuspended in 0.5 ml EMEM-2.5, and used for repeated positive selection. After 5 or more rounds of purifying positive selection, recombinant MVAs were amplified in CEFs to make crude stocks. Recombinant MVA expressing the bacteriophage T7 RNA polymerase (MVAGKT7) was provided by Gerald R. Kovacs (National Institutes of Health, Bethesda, MD).

293T cells in 6-cm wells were transfected in duplicate with pCAGGS constructs using FuGene 6 transfection reagent (Roche, Indianapolis, IN) according to the manufacturer's instructions. Unless otherwise specified, 1 μg of each plasmid was used per well. Empty vector was used to make the total DNA amount 4 μg/well. Vero cells were infected with recombinant MVAs at an MOI of 3–5 in a minimal volume of EMEM containing 2.5% serum. At 24 h post transfection or 6 h post infection, cells were overlaid with methionine-cysteine-free minimal essential medium (MEM) (Invitrogen, Gaithersburg, MD) containing 2.5% dialyzed fetal calf serum (Invitrogen, Gaithersburg, MD) and 100 μCi/ml ³⁵S-cys/met Redivue Promix (Amersham Pharmacia Biotech, Piscataway, NJ), and incubated at 37°C for transfected cells, or 31°C for infected cells. For pulse-chase labeling, cells were washed then starved in methionine-cysteine-free MEM for 45 min followed by metabolic labeling as, as described above, for 15 min. Cells were washed once then chased with DMEM-10.

Cells were harvested by scraping, pelleted by centrifugation at 5000 × g for 5 min, and then washed once with PBS and pelleted again. The pellet was resuspended in 200 μl lysis buffer (100 mM Tris-HCl, pH 8.0; 100 mM NaCl; 1.0% Triton-X 100) containing Complete, Mini protease inhibitors at a 1× concentration (Roche, Indianapolis, IN), and incubated on ice for 10 min. After removing nuclei by centrifugation, lysates were pre-cleared by incubation with Protein G-Sepharose (Amersham Pharmacia Biotech, Piscataway, NJ) for 30 min. Lysates derived from a VLP detection assay were frozen at -80°C until immunoprecipitation. Typically 1–2 μl of appropriate antiserum was used for each sample and antisera and lysates were incubated at 4°C overnight, followed by addition of Protein G-Sepharose for 45 min. Protein G beads were washed twice with lysis buffer followed by one wash with lysis buffer containing 0.1% sodium deoxycholate and 0.1% SDS. Proteins were separated either by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on a 10% polyacrylamide gel, or by a NuPAGE Novex 4–12% Bis-Tris gel (Invitrogen, Gaithersburg, MD) and visualized by autoradiography.

293T cells were transfected, and Vero cells were infected with recombinant MVAs, as described above. At 20–24 h p.t. or 48 h p.i., the cell culture medium was removed, clarified, and then centrifuged through a cushion of 10% sucrose (w/vol) in NTE (100 mM NaCl; 10 mM Tris-HCl, pH 7.5; 1 mM EDTA) at 200,000 × g for 2 h at 4°C. The resulting pellet was re-suspended in 4 ml NTE and 1.3 ml 80% sucrose. A discontinuous sucrose gradient was formed by overlaying with 1.8 ml 50% followed by 0.6 ml 10% sucrose in NTE. The gradient was centrifuged at 200,000 × g for 16 h at 4°C in a SW50.1 rotor. Typically, two 0.7 ml fractions were removed from the top of the gradient, diluted with 2× lysis buffer, and analyzed by immunoprecipitation. The two fractions were combined during the first wash after Protein G-Sepharose addition. Proteins from 1/20 of cell lysates from MVA infections, and half of cell lysates from transfected cells, were used for immunoprecipitation. For samples derived from transfection, 1/3 of the sample was loaded on gels (equivalent to 1/6 total lysate). Release efficiency was quantified by performing densitometry analysis on scanned film images using AlphaEaseFC software (Alpha Innotech Corporation, San Leandro, CA). Percent release was calculated as the fraction of protein derived from the supernatant divided by total protein detected (total lysate + supernatant).

Clarified culture supernatants of MVA-infected Vero cells were centrifuged at 200,000 × g for 2 h at 4°C. The resulting pellet was resuspended in 200 μl NTE and added to the top of a continuous gradient of 5–45% sucrose. Clarified supernatants from transfected cells were added directly to the gradient. The gradient was centrifuged in an SW40 Ti rotor at 200,000 × g for 16 h at 4°C. Fractions were collected from the bottom and 50 μl of each fraction was set aside for density measurement. The remainder of each fraction was combined with 4× lysis buffer (pH 7.5) and immunoprecipitated as described. Density was determined based on refractive index as measured with a refractometer. Culture supernatants of NiV-infected Vero cells were clarified at 20,000 × g for 10 min at room temperature and 100 μl of clarified supernatant containing approximately 10⁶ TCID₅₀ was added to the top of a continuous gradient of 5–45% sucrose. The gradient was centrifuged in an SW41 Ti rotor at 200,000 × g for 16 h at 4°C. Fractions were collected from the bottom and 50 μl of each fraction was set aside for density measurement. A portion (140 μl) of each fraction was extracted using the QIAamp Viral RNA Mini kit (Qiagen GmbH, Hilden) and extracted RNA was analyzed by quantitative real-time PCR as previously described 74. Threshold cycle (Ct) values were used as a proxy for virus concentration and density was determined based on refractive index as measured with a refractometer.

VLPs released from transfected 293T cells into the culture supernatant were prepared as described above except the top 1.4 ml of the flotation gradient was mixed with 3 ml of PBS and centrifuged for an additional 2 h after which the pellet was resuspended in 60 μl PBS. VLPs were adsorbed onto carbon-coated parlodion copper grids and immunolabeled using either polyclonal HeV G-specific mouse antiserum or anti-NiV M monoclonal antibody F45G4, followed by secondary antibody conjugated to 12 nm gold beads. For detection of M, immuno-labeling was done in the presence of 0.05% saponin. Samples were negatively stained with 1% uranyl acetate and examined with a Hitachi 7600 transmission electron microscope operated at 80 kV.