HIV-1 variants were isolated from HIV-1 infected individuals of Henan and Anhui province, treated time range 6-18 months. those isolate had been identified as drug-resistance using both genotypic assay and phenotypic assay 6 . SF33, dual tropic, use CCR5 and CXCR4 coreceptor for entry cells, as positive control.

GHOST cells were derived from the human osteosarcoma cell line, HOS, stably express CD4 and the chemokine receptor CXCR4 or CCR5. The GHOST parental cell expressing human CD4 was grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1% glutamine, 2% penicillin plus streptomycin, Geneticin (500 μg/ml, Gibco, Paisley, Scotland), hygromycin (100 μg/ml, Gibco). GHOST cells expressing one of the coreceptors CCR5 and CXCR4 were cultivated in medium additionally supplemented with puromycin (1 μg/ml; Sigma, Deisenhofen, Germany) 7 8 .

Human peripheral blood mononuclear cells (PBMC) were obtained by Ficoll density centrifugation. were grown in an RPMI 1640(Gibco)-based culture medium supplemented with 10% fetal calf serum (HyClone, Logan, Utah), 2 mM L-glutamine(Gibco), penicillin (100 U/ml), streptomycin (100 mg/ml), and 20 U/ml of recombinant interleukin-2.

Coreceptor usage was determined with the GHOST(3)-CXCR4 and GHOST(3)-CCR5 cell lines 7 8 . Briefly, GHOST cells were seeded in 24-well plates (Corning Incorporated) at 6*10⁴cells/well. On the following day, the medium was removed, infected with virus stocks in the presence of 8 μg/ml DEAE to enhance infection efficiency. Cells were harvested at 48 h after infection, then using flow cytometer (Elite ESP, Beckman Coulter) to analyze the GFP expression. A total of 10,000 to 15,000 events were scored. We expected an approx 10-fold shift in mean GFP fluorescence of infected cells over non-infected 8 . A positive control (SF33) and cell control were included in each experiment to assess inter-assay variation and cell auto fluorescence.

At least 2 HIV-1 negative PBMC and HIV-1 variant were coculture 9 . Briefly, 5*106 PBMC cells from normal seronegative donors were stimulated with 1 ug of PHA per ml for 2-3 days, were infected overnight with 2 ng of p24 antigen equivalent of each viral isolate, washed, and resuspended in complete medium supplemented with recombinant interleukin-2. Aliquots of virus supernatant were collected every 2 to 3 days and monitored for p24 antigen production over 13 days with a commercially available ELISA (Vironostika HIV-1 Microelisa system, bioMérieux, France)

RNA was extracted from the plasmas and HIV variants using a QIAamp^® Viral RNA Mini Kit (Qiagen Inc., Chatsworth, CA).

For synthesis of cDNA, 5 μl extracted RNA, 10 pmol downstream PCR primer (RT21: CTGTATTTCTGCTATTAAGTCTTTTGATGGG; HXB2 3509-3539), M-MuLV reverse transcriptase (NEW ENGLAND BioLabs) and Ribonuclease Inhibitor (TaKaRa Biotechnology) were run for 60 min at 45°C in a thermal cycler (GeneAmp^® PCR system 9700, Applied Biosystems, Foster City, CA). A nested PCR strategy was employed to amplify the 1,100-bp RT fragment. cDNA (10 μl) was used as a template and the outer primer set (MAW 26: TTggAAATgTggAAAggAAggAC; HXB2 2027-2050 and RT21) was used in the first round of PCR. The amplification was done at 94°C for 5 min, followed by 35 cycles at 94°C for 20 sec, 55°C for 20 sec and 72°C for 2 min, and finally an extension of 7 min at 72°C. The first-round PCR product (5 μl) and the inner primer set (PRO-1: CAgAgCCAACAgCCCCACCA; HXB2 2147-2166 and RT20: CTgCCAgTTCTAg CTCTgCTTC; HXB2 3441-3462) were used in the second round of PCR. The amplification was performed at 94°C for 5 min, followed by 35 cycles at 94°C for 20 sec, 55°C for 20 sec, and 72°C for 1 min, and finally an extension of 7 min at 72°C.

The nested PCR product was purified using a QIAquick Gel Extraction Kit (Qiagen Inc., Chatsworth, CA). DNA was sequenced with the ABI 3100 DNA Sequencer (Applied Biosystems Inc). The primers used for DNA sequencing were PRO-1, RT-20, RT-A (gTTgACTCAgATTggTTgCAC; HXB2 2519-2539), and RT-B (CCTAgTATAAACAATgAgACAC; HXB2 2946-2967).

The pol gene of HIV-1 subtype B' were sequenced and compared to the consensus B reference sequence, using the HIVdb software (Stanford HIV Drug Resistance Database, http://hivdb.stanford.edu) to detect drug resistance mutations.

Difference between R5 drug resistance variants and R5X4 drug resistance variants were compared using T analysis. Two-tailed P values less than 0.05 was considered statistically significant. All statistical analyses were completed by the GraphPad5.0 software.

13 HIV-1 variants were isolated from AIDS patients (4 male and 9 female; average 40.3 years old) were recruited for this study. 4 patients received AZT + ddI + NVP, and 9 were treated with d4T + ddI+ NVP for 6 months or longer. The average viral load was 8.08 × 10⁵ copies/ml (range from 5.0 × 10² ~ 4.0 × 10⁶ copies/ml), and the average CD4 count was 151 cells/ul (range from 63 ~ 348 cells/ul).

Using GHOST cell line to determined the coreceptor usage, We found 5/13 viral variants were CCR5-tropic(R5) as determined by parallel infection of GHOST(3)-CXCR4 and GHOST(3)-CCR5 cells, 8/13 viral variants were CCR5 and CXCR4-tropic(R5X4). Among 13 drug-resistant variants, the CD4 T counts of R5X4 variants were 97.9 (range from 63 to 186), while that of R5 variants were 236.2 (range from 144 to 348/μl; P = 0.04). The R5X4 variants mainly appeared in CD4 counts <200/ul. Viral load of R5X4 variants were 4.91 ± 1.58, while that of R5 variants were 5.67 ± 0.33. There was no difference in viral load between R5X4 variants and R5 variants (P = 0.32). The average time under HAART were no difference between R5X4 variants and R5 variants, 13.1 and 15.6 months, respectively (P = 0.4).

HIV-1 variants growth kinetics analyzed by determined the level of p24 antigen at 1, 3, 7, 10, 12 days after HIV-1 variants infection. All HIV-1 variants were able to yield productive infections in PBMCs assay. But all HIV-1 variants produce less 10000 pg/ml at 12 day. Compare the p24 values at 1, 3, 7, 10, 12 day, the growth kinetics of R5-tropic HIV-1 variants was similar with R5X4-tropic HIV-1 variants (fig 1A, p > 0.05).

Although the mean p24 antigen level of R5-tropic variants was lower than that of R5X4 variants. In some case, R5 variants replicated more efficiently than R5X4 viruses, for example, V13 variant was more efficiently than V1, V3, V4 and V5 variant (fig 1B).

HIV-1 variants placed in a humidified chamber at 37°C with 5% CO₂ air and maintained for 4 weeks without antiretroviral drugs. Compare the drug resistant mutations of pol gene between first and fourth variants. There was no primary drug mutation of protease both in first and fourth HIV-1 variants. In first HIV-1 variants, 37 primary drug mutations including 16 NRTI mutations and 21 NNRTI mutations were detected. For NRTI, there were 4 HIV-1 variants were mutated at 215 site, including T215Y and T215F mutation. The most frequency mutations of NNRTI were at 181 and 103 site (fig 2). 32 primary drug mutations including 13 NRTI mutations and 19 NNRTI mutations were detected in fourth HIV-1 variants. The most frequency mutation of NRTI was at 215 site. There were 7 mutations at 181 site, and 6 mutations at 103 site, for NNRTI.

Compare the drug resistant mutation at 215 site between first and fourth variants, there were no difference. The mutation at 181 site was lost in one HIV-1 variant, and emergent in another HIV-1 variant. K103N mutation was lost in one variant after coculture.

The NRTI drug resistant mutations lost in 3 strains after coculture, including T69APST, M41LM, and A62V. One drug resistant mutation (L74V) changed to V75T. The NNRTI drug resistant mutations lost in 3 strains, including K103N, K101*EKQ, Y181C and V108FILV. 2 drug resistant mutations (V108I and Y181C) emergent after coculture. One drug resistant mutation (G190EV) changed to G190A (table 1).