Table 1

List of primers used
Gene Primer 1 (5′→ 3′) Primer 2 (5′→ 3′) Amplicon (bp)
GAPDH GAACGGGAAGCTTGTCATCA TGACCTTGCCCACAGCCTTG 473
IFNα4 AGCCTGTGTGATGCAGGAACC CAGCAAGTTGGTTGAGGAAGAG 171
ISG56 CTCAGAGCAGGTCCAGTTCC TCCATCTCAGCACACTCCAG 300
TNFα ACGGCATGGATCTCAAAGAC CGGACTCCGCAAAGTCTAAG 325
CHIKV_E1 AAGCTYCGCGTCCTTTACCAAG CCAAATTGTCCYGGTCTTCCT 209
Probe_E1 FAM – CCAATGTCYTCMGCCTGGACACCTTT - TAMRA
CHIKV_E2 ACKCTGACRGTGGGATTYAC ACGTGCTGCAAGGTARCTCT 139
CHIKV_Pos ACGTGCTGCAAGGTARCTCT
CHIKV_Neg ACKCTGACRGTGGGATTYAC

Kumar et al.

Kumar et al. Virology Journal 2012 9:313   doi:10.1186/1743-422X-9-313

Open Data