Table 1

siRNA and oligo-primer sequences for this study
No. Sequence (5’-3’) Note
1 GGAACGUAUAAAAGCAGAAtt siRNA seq for mouse gene Gbp1
2 AAGGCAUGUACCAUAAGCUtt siRNA seq for human gene GBP1
3 AGAGGGAAATCGTGCGTGAC Forward primer for qRT-PCR of mouse beta-actin
4 CAATAGTGATGACCTGGCCGT Reverse primer for qRT-PCR of mouse beta-actin
5 GGGCATGGAGTCCTGTGGCA Forward primer for qRT-PCR of human beta-actin
6 GGGTGCCAGGGCAGTGATCTC Reverse primer for qRT-PCR of human beta-actin
7 CATTCCAAGTGAGAATCTCTTTGTCA Forward primer for qRT-PCR of DENV E gene
8 CAGATCTCTGATGAATAACCAACG Reverse primer for qRT-PCR of DENV E gene
9 GGGCAGCTGTCTTTGGGTAGAC Forward primer for qRT-PCR of mouse Gbp1 gene
10 AGCATGAGGCCCTAGGAGCTGT Reverse primer for qRT-PCR of mouse Gbp1 gene
11 AAGAGAGGACCCTCGCTCTTA Forward primer for qRT-PCR of human GBP1 gene
12 ATGCCTTGGTTAGGGGTGAC Reverse primer for qRT-PCR of human GBP1 gene

Pan et al.

Pan et al. Virology Journal 2012 9:292   doi:10.1186/1743-422X-9-292

Open Data