Table 2

Oligonucleotides used in this study
Oligo name Note Sequence (5– 3)
MDS-4 Reverse transcription CGCTCTTCCGATCTNNNNNN
MDS-189 Library amplification CTGTCTGGCTCTTCCGATCT
MDS-115 Degenerate astrovirus consensus CCATCAGGTCARWWNTCAACAAC
MDS-116 Degenerate astrovirus consensus CTCGCTAATHTAYGGDGATGA
MDS-117 Degenerate astrovirus consensus GGTTTNACCCACATNCCAAA
MDS-118 Degenerate astrovirus consensus GTCCAACTGTGADNCCACARAA
MDS-119 Rabbit astrovirus diagnostic ATAATAACATGGTCAACTATTGGCTTC
MDS-120 Rabbit astrovirus diagnostic GACATCCTTATACATTTTCACAACTTT
MDS-156 Vertebrate rRNA (L2513) GCCTGTTTACCAAAAACATCAC
MDS-157 Vertebrate rRNA (H2714) CTCCATAGGGTCTTCTCGTCTT
MDS-298 Genome recovery and sequencing (27–46 forward) CGGCCAGAGAGCCTATTACC
MDS-296 5 RACE (149–168 reverse) GGCTAGAGGAATGGGGTCAG
MDS-299 Genome recovery and sequencing (1146–1165 forward) GCTCGTTCCGATAATTGCTC
MDS-300 Genome recovery and sequencing (1229–1248 reverse) GCAACTAACCACGCACAATG
MDS-144 Genome recovery and sequencing (2554–2564 forward) TCTGGACYGARGARGARTA
MDS-300 Genome recovery and sequencing (2639–2659 reverse) CACTCCATTCAGGGTAACCAA
MDS-135 Genome recovery and sequencing (3573–3592 forward) TCCACTCCCGCCTACCCCAA
MDS-145 Genome recovery and sequencing (3622–3641 reverse) CCACCCACAATCAGAGAGGT
MDS-119 Genome recovery and sequencing (4165–4191 forward) ATAATAACATGGTCAACTATTGGCTTC
MDS-125 Genome recovery and sequencing (4287–4308 reverse) CATAATCAGATGGGAGGACAGG
MDS-147 Genome recovery and sequencing (4602–4620 forward) CTTCGCAGCCACTCTCTTG
MDS-137 Genome recovery and sequencing (4668–4683 reverse) TTGGTCCTCCCCTCCA
MDS-138 3 RACE (5719–5729 forward) TGGTGGTTTGT
MDS-150 Genome recovery and sequencing (5759–5779 reverse) TCTGAAATTGCACTGTGTTGG
MDS-121 RACE oligo-dT primer CCAGTGAGCAGAGTGACGAGGACTCGAGCTCAAGCT17
MDS-122 RACE outer adapter primer CCAGTGAGCAGAGTGACG
MDS-123 RACE inner adapter primer GAGGACTCGAGCTCAAGC

Stenglein et al.

Stenglein et al. Virology Journal 2012 9:216   doi:10.1186/1743-422X-9-216

Open Data