Table 1

Primers used for sequencing reactions
Oligonucleotides Locationa sequence
1 F 190-209 GCGTTCCGTCGCCTTCTACA
1R 2751-2729 CAGGAATCTGGAAGACACTTGCA
2 F 2663-2684 GTATTATGCCACCAGTGTCCCA
2R 4957-4938 CAGTTGCCAGCAGGCACTGT
3 F 4887-4906 ACCAGCGGTGCATTGCTTGA
3R 7475-7453 CAATGTGCTCTTGCAATCCTGCA
4 F 7327-7350 CTGTTAAGTTAGTGGACTCAGCGT
4R 9875-9856 ACTAGCGCCTTCAACTTGCA
5 F 9712-9731 GCGCTTGTGGTTCACCTGGT
5R 12259-12240 GGATCCACAGCGAAAGCGCA
6 F 12182-12202 ACGCTTGCAGGCTGGTAAACA
6R 14462-14442 TGGGCAGTGCTCTATCGCACT
7 F 14322-14341 ATACTAGGGGCGCTTCGGTT
7R 16780-16760 GTCAGGGTGCACAGGAATGAA
8 F 16662-16684 GTATGTGTGCCCTTAAGCCTGAT
8R 19002-18980 GTAAGTGGACGTTCGGCTTCATA
9 F 18874-18898 CGTAGCTTTTGAGTTGTATGCCA
9R 21330-21309 GCAATTAGCTGTACAGGGTTCA
10 F 21080-21101 CCATTCCAGCTTATATGCGTGA
10R 23487-23465 GTACATGTGAAGCTTCTCAGCGT
11 F 23272-23292 GTGTACGATCCTGCAAGTGGC
11R 25715-25694 TCACCTCATCAACGGGAATAGA
12 F 25535-25557 TCGTCCAATTGGTTAATCTGTGC
12R 27840-27820 TACCGTTGTGTGCAAGACCAA
5’ RACE Primer 307-288 TTGCTAGCCATAGCCGGCAG
3’Race Primer 27725-27747 CTATGTTCCAGGGTAGTGCCATT

aLocation corresponds to position within the CV777(AF353511) genome.

Pan et al.

Pan et al. Virology Journal 2012 9:195   doi:10.1186/1743-422X-9-195

Open Data