Table 1

Sequences of primers

Name

Type

Sequences (5' to 3')

Length(nt)

Amplicon (bp)


P1

Forward

    GGATCC
ATGGCCGACGCGAAGGCGGT

26

799

P2

Reverse

    CTCGAG
GCTTGGGTCTTTACTTTTTGCGCGGAAC

34

P3

Forward

TATTCTTCTGCGGGCTCA

18

124

P4

Reverse

CATAGACGATGCTCC

15

P5

Forward

CCGGGCATCGCTGACA

16

178

P6

Reverse

GGATTCATCATACTCCTGCTTGCT

24


The underlined sequences of P1 and P2 are BamH I and Xho I restriction sites, respectively.

Wu et al. Virology Journal 2011 8:266   doi:10.1186/1743-422X-8-266

Open Data