Table 1

Primers sequences used sequencing analysis of the adenovirus hexon gene

primers

Sequence (5'-3')

position

amplicon length(bp)


1U

GAACAGCATCGTGGGTCT

18186-18203

499

1L

GGACCTCTATCAAGCAC

18668-18684

2U

CGGGAGGACAATACATAC

18569-18586

512

2L

CCTTCGGTTGGTGTTACT

19063-19080

3U

AGCCTCAAGTTGGAGAAGA

18909-18927

522

3L

GCAAAAGCTGATATGACAG

19412-19430

4U

CATTGGCTTCAGGGATAAC

19288-19306

478

4L

TGGCGTGTACTTGTAAAC

19748-19765

5U

GGCAACAATCTGGCTATG

19661-19678

493

5L

GAGGTTGATGCTGGTGAA

20136-20153

6U

TGGAAATGACCTCAGAAC

20089-20106

515

6L

GAACCAGGAACCAGTCTT

20586-20603

7U

GTGGATGGGGAAGGATAC

20543-20560

506

7L

TAAAGCAGGGTGGGCTCA

21031-21048

8U

CATACCGTTCTCCAGCAACT

20914-20933

509

8L

ATCAAAAAGGTAGCAGGT

21405-21422

9U

CGCCATAGTCAACACTGC

21330-21347

486

9L

TATCCATACGGTCAAACG

21798-21815


Tang et al. Virology Journal 2011 8:23   doi:10.1186/1743-422X-8-23

Open Data