Table 1

Top 20 high frequency sequences in raw sequencing data

read sequence

frequencies

genome presence


rank

total

1.fq

2.fq

Ori1

Pos2

Junction3


GCTCTTCGGAAAGGTCAAAAACAGTTTGAG......

1

828

427

401

F

30641

tctatttggagctcttcgga


GTTTTACAGAATCGTACTCGGCCTTGTTCG......

2

705

388

317

F

3272

aattactggagttttacaga


GTATAATGATTCATCAACAAACAAAAGACA......

3

692

383

309

R

30486

cccttttggagtataatgat


GCGTAATTCCACCTTTTTCTTCCCAATCTT......

4

673

352

321

F

52555

tcttgttggagcgtaattcc


GGTATACATCATTAAATAACGATGTATATC......

5

641

333

308

F

163251

agaaattggaggtatacatc


GTATTTCAAGAAACGTGATAAAGCCCAGGC......

6

577

318

259

F

121764

aacgtttggagtatttcaag


GCGTAATTGCTTCAGGTAAGCCTTTAGGAT......

7

505

256

249

F

73140

agaatatggagcgtaattgc


GTGCATGATTGGTAACAGTTCGGCAACCCA......

8

505

277

228

F

40411

ggtctttggagtgcatgatt


GTTTTACAGACAACGCAAATCTTATCTGAC......

9

496

253

243

F

115803

atcgattggagttttacaga


GCTGAAAAGGCAGCTGAAACTAAAGCCGCT......

10

494

270

224

R

3702

taaattagcagctgaaaagg


GTATAATGTAAAAACAAACCTGAGGAAATT......

11

490

274

216

R

32654

ctcccttggagtataatgta

GTATTAACAAGATTCCAGAATTTCTCACCC......

12

481

253

228

R

75276

gttttctggagtattaacaa


GTTTCTCAGCGATTTTAATCGACCACTCTT......

13

448

238

210

F

29924

tcgtcttggagtttctcagc


GTTACATAAGCATCAGGAGCAGATGGTCCC......

14

445

254

191

R

102003

ttgctttggagttacataag


GCTTTAATCTTAACAATAGTGCCGAGATAA......

15

443

245

198

F

165136

gtatttacctgctttaatct


GCTGAACGTACCGAAGTTGCAGGTATGACT......

16

440

266

174

R

28799

gttgttcagagctgaacgta


GTATAATCTTTCTATCAACTTGAGGAGAAT......

17

434

217

217

R

46215

gatggatggagtataatctt


GCTGCATCTTCAGATTGGTCTTCGTCTTCA......

18

431

251

180

F

5448

ttcagatggagctgcatctt


GTTATTACTAAACAAGTTTTTAACCGCACT......

19

426

222

204

R

122567

ctcccttggagttattacta


GTTAACAAATGCCATACGACATTTAAGGGA......

20

425

208

217

F

56968

aacgtttagagttaacaaat


1 Orientation in genome. F, forward; R, reverse.

2 Position in genome.

3 The genomic sequence around the start site of the HFSs.

Jiang et al. Virology Journal 2011 8:194   doi:10.1186/1743-422X-8-194

Open Data