Table 1

Synthetic oligonucleotides used for amplification of the FMDV genomea

Primers

Position

Sequence(5'-3')

Fragment


S1 b

Used for 5'-RACE

CATGGCTACATGCTGACAGCCTA

5'RACE

S2

344-367

TGAAAGGCGGGCGCTTGGTGACA

5'RACE

U1

379-399

TAAgTTTTACCGTCGTTCCC

UFR

U2

718-736

ACCGAGCGTGGAGTCAAT

UFR

A1

524-541

CGGAAGTAAAACGGCACA

A

A2

2276-2293

GATTTCCAACAGCGGTCA

A

B1

2217-2233

CGTGTTTGGCAGCCTCAT

B

B2

4700-4717

CCACGGGTTCAGGTCTCG

B

C1

4576-4593

AACGGCCCAAGCAAGTAT

C

C2

6599-6616

TGGAAACGCACGAGCAGT

C

D1

6205-6222

GGCAGAGCCATGACAGAC

D

D2

7458-7475

GGGTGGAAGCCAAACTCT

D

GSP1

7446-7463

GGTGTTTCGCACAGAGTT

3'RACE

R1

3'end

TAAgCAAgCATgCCATATgTT

3'RACE

3' RACERTc

Used for 3'-RACE

TAAgCAAgCATgCCATATg(T)15


a The primers used in this study were designed based on JS/CHA/05 (Accession NO. EF149009)

b S1 was used in 5'-RACE for amplification of the 5' end of RNA.

c 3'RACERT was used in 3'-RACE for amplification of the 3' end of RNA.

Yang et al. Virology Journal 2011 8:175   doi:10.1186/1743-422X-8-175

Open Data