Table 2

Oligonucleotide primers and probes used in this work

Primers

Sequence (5'-3')


myxE3Lfor

TAACAACCGCCGTAAATGTG

myxE3Lrev

GCAAACCAAAAATCCGTGTAC

MyxM029Lfor

GTTGGTAATTTCATTTCGTACCA

MyxM029Lrev

GGTAAACAATTAATCCGTTGTAA

M135Rfor

CCATACAGAAAGAGATTCAGTTGGA

M135Rrev

GGAGTCTGTATACAGTGATAAATCCTT

M135RXFOR

CC

    CTCGAG
ATAAACATGGTGTTTATATTTATTATC

M135RAPAREV

TT

    GGGCCC
TTACAGGACGCCTAAGGATATC

CATBamfor

TA

    GGATCC
GGGATGGAGAAAAAAATCACTGG

CATXSrev

CC

    GTCGAC
TTA
    CTCGAG
CGCCCCGCCCTGCCACTC

M138Lfor

TTAGGAAGATGTCCAGGAATC

M139Rrev

CCGTATTTGTTCGGCAGACC

M153Rfor

GTGTATAGACTGTCGTACCTAC

M154Rrev

ACGGCAATCAACTTCCCGAC

M009Lfor

CAACTGGGATTTCTGCGTAC

M009Lrev

GACGTAATGCGTCGGCGTG

M036Lfor

CAACAGAACGGCAACAATTTATGT

M036Lrev

ACGTGCAGTAACGCCTGTTC

M148Rfor

CGACCATCTGATAATGTATGTC

M148Rrev

ACAGGGATCGAGAGTGAACG

Probe

SwinemyxE3LCOMP

6FAM-CTCAACGAATATTGTCAGATTA-MGBNFQ


Added restriction enzyme sites within the primer sequences are underlined and nucleotides corresponding to the initiation and termination codons within the M135R and CAT sequences are indicated by bold italics.

Belsham et al. Virology Journal 2010 7:7   doi:10.1186/1743-422X-7-7

Open Data