Table 1

Primers used for PCR amplification of VP1 and TCR sequences

Primer name

Sequence (5' > 3')


ChPyV VP1 assay


ChPyV-Fout

GTTATTCATCATGCAGATGG


ChPyV-Rout

TCAGCTAATTTAGCTATATC


ChPyV-Fin

GAACACAGACATGACCTGTG


ChPyV-Rin

GTATAGCTGAAGCATATTTAG


ChPyV TCR assay


TCRoutF

AAAGTTTTACATCATAGCAATCAGA


TCRoutR

AGAGGGCTTCAATAGTCAATCCAGA


TCRinF

GACCCTCTTGAAATTTTTGCCACAGT


TCRinR

TTAGTTCAGAAGCCATCACAATCATA


Deuzing et al. Virology Journal 2010 7:347   doi:10.1186/1743-422X-7-347

Open Data