Table 1

Selected primers for the OPV/PPV nested-multiplex PCR

Genus

Target gene

Primer sequence (5' - 3')

Reference


OPV

vgf

1st step

vgfF: CGCTGCTATGATAATCAGATCATT

Fonseca et al., 1998

vgfR: GATATGGTTGTGCCATAATTTTTAT

Nested step

vgfF2: ACACGGTGACTGTATCCA

This study

vgfR2: CTAATACAAGCATAATAC

PPV

b2l

1st step

OVB2LF1: TCCCTGAAGCCCTATTATTTTTGT

Hosamani et al., 2006

OVB2LR1: GCTTGCGGGCGTTCGGACCTTC

Nested step

PPP-1: GTCGTCCACGATGAGCAG

Inoshima et al., 2000

PPP-4: TACGTGGGAAGCGCCTCGCT


Abrahão et al. Virology Journal 2009 6:140   doi:10.1186/1743-422X-6-140

Open Data