|
Small interfering RNA |
|||
| Name |
Virus |
Start Nucleotide |
Target Sequence |
|
|
|||
| Cap |
WNV Lineage I |
312 |
gaacaaacaaacagcgatgaa |
| Cap-Mut |
WNV Lineage I |
312 |
gaagaaagaaagaccgatgaa |
| M2 |
Influenza A M2 |
18 |
ggtcgaaacgcctatcagaaa |
| 3110 |
WNV Lineage I |
3110 |
gggcagttctgggtgaagt |
| 3317 |
WNV Lineage I |
3317 |
ctacggtcaccctgagtga |
| 4119 |
WNV Lineage I |
4119 |
gaggagcaagtctgctatgc |
| 4823 |
WNV Lineage I |
4823 |
gtgtcaaggaggatcgact |
| 5039 |
WNV Lineage I |
5039 |
gacggtgatgtgattgggct |
| 5497 |
WNV Lineage I |
5497 |
gcagcaagaggttacattt |
| 6337 |
WNV Lineage II |
6337 |
gttgaagtcatcacgaagt |
| 6349 |
WNV Lineage I |
6349 |
gtggaagtcatcacgaagc |
| 6915 |
WNV Lineage I |
6915 |
caacgagatgggttggcta |
| 7353 |
WNV Lineage I |
7353 |
gaagaacgctgtagtggat |
| 7693 |
WNV Lineage I |
7693 |
ggacgcaccttgggagaggt |
| 8892 |
WNV Lineage I |
8892 |
ggtcaacagcaatgcagct |
| 8898 |
WNV Lineage I |
8898 |
cagcaatgcagctttgggt |
| 9095 |
WNV Lineage I |
9095 |
gaagcagagccatttggtt |
| 9607 |
WNV Lineage I |
9607 |
gggaaaggacccaaagtca |
| 10355 |
WNV Lineage I |
10355 |
gagagatatgaagacacaac |
|
siRNA were generated against 19–21 nucleotide sequences corresponding to the target region of different parts of the New York 1999 WNV genome. Sequences were chosen using the SciTools RNAi design program and compared against the GenBank database to exclude sequences that may affect cellular genes. | |||
Geiss et al. Virology Journal 2005 2:53 doi:10.1186/1743-422X-2-53 |
|||