Table 1

Oligonucleotides of vector-delivered pre-miRNAs
Name Single stranded DNA sequences (5′ → 3′) Position
pmiR153 Top strand TGCTGCTCCTTGGTAACAAGGACCCAGTTTTGGCCACTGACTGACTGGGTCCTTTACCAAGGAG 151–171
Bottom strand CCTGCTCCTTGGTAAAGGACCCAGTCAGTCAGTGGCCAAAACTGGGTCCTTGTTACCAAGGAGC
pmiR220 Top strand TGCTGGCACGGCAACTTTACTGTGAAGTTTTGGCCACTGACTGACTTCACAGTAGTTGCCGTGC 220–240
Bottom strand CCTGGCACGGCAACTACTGTGAAGTCAGTCAGTGGCCAAAACTTCACAGTAAAGTTGCCGTGCC
pmiR242 Top strand TGCTGCCACCTTAAGGTGACACTGATGTTTTGGCCACTGACTGACATCAGTGTCCTTAAGGTGG 243–263
Bottom strand CCTGCCACCTTAAGGACACTGATGTCAGTCAGTGGCCAAAACATCAGTGTCACCTTAAGGTGGC
pmiR276 Top strand TGCTGCACTGGTGACAGGCTAAGGATGTTTTGGCCACTGACTGACATCCTTAGTGTCACCAGTG 277–297
Bottom strand CCTGCACTGGTGACACTAAGGATGTCAGTCAGTGGCCAAAACATCCTTAGCCTGTCACCAGTGC
pmiR-NC Top strand TGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Heterologous
Bottom strand CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTC

The sense sequences of predicted miRNAs targeting the FMDV IRES are shown in bold and italic.

Chang et al.

Chang et al. Virology Journal 2014 11:1   doi:10.1186/1743-422X-11-1

Open Data