Table 4

Primers used for HPV16 E6 gene and HPV16 LCR amplification
Primers Sequences (5to 3’) Positions Product size (bp)
E6-1 F TTGAACCGAAACCGGTTAGT nt 46–65 211
E6-1R GCATAAATCCCGAAAAGCAA nt 237–256
E6-2 F GCAACAGTTACTGCGACGTG nt 204–224 235
E6-2R GGACACAGTGGCTTTTGACA nt 419–438
E6-3 F CAGCAATACAACAAACCGTTG nt 371–391 220
E6-3R TCATGCAATGTAGGTGTATCTCC nt 568–590
LCR1-F GAAAACGAAAAGCTACACCCA nt 7083-7104 286
LCR1-R CAATGAATAACCACAACACAATTA nt 7345-7368
LCR2-F GCTTGTGTAACTATTGTGTCATG nt 7289-7311 292
LCR2-R GTGCAGGTCAGGAAAACAG nt 7562-7580
LCR3-F ACTTGTACGTTTCCTGCTTG nt 7525-7544 350
LCR3-R GTGTAACCCAAAATCGGTTTGC nt 7853-7874
LCR4-F GTCACCCTAGTTCATACATGA nt 7777-7797 231
LCR4-R TGCAGTTCTCTTTTGGTGC nt 85-103

Pientong et al.

Pientong et al. Virology Journal 2013 10:30   doi:10.1186/1743-422X-10-30

Open Data