Table 1

Sequences of primer pairs used for qRT-PCR
Gene Forward primer (5’-3’) Reverse primer (5’-3’) Product(bp) Accession no.
Cyclin A AAGTTTGATAGATGCTGACCCGTAC GCTGTGGTGCTCTGAGGTAGGT 194 GQ265874
GRP78 AATGGCCGTGTGGAGATCA GAGCTGGTTCTTGGCTGCAT 114 X92446
IL-8 CTGGCTGTTGCCTTCTTG TCGTGGAATGCGTATTTATG 113 M86923
Bcl-2 TTGTGGCCTTCTTTGAGTTCG CTACCCAGCCTCCGTTATCC 150 XM_003121700.1
β-actin GGACTTCGAGCAGGAGATGG AGGAAGGAGGGCTGGAAGAG 138 XM_003124280.1

Xu et al.

Xu et al. Virology Journal 2013 10:26   doi:10.1186/1743-422X-10-26

Open Data