Table 2

Primers used for RT-PCR and sequencing of Sing-M105-02 and Sing-M100-02 virus isolates
Primer designation Sequence (5′ to 3′) Nucleotide position Forward/Reverse Primer reference
(estimated)
EMCVF445 TTTGCAGGCAGCGGAATC 490 Forward This study
M105R524 CGTGCCGCCTTTGCAGGTGTCTG 524 Reverse This study
M105R870 CCATTTCTGTATTGCAGGGCAGAGC 870 Reverse This study
EMCVF1070 TAATGCAGCCGGGTCTGACC 1070 Forward This study
M105R2369 CAAAATAACTGAGTTTGGAC 2369 Reverse This study
EMCV2737R GCTACAAAATCTGGAGTAGCA 2689 Reverse This study
EMCV-P10 TGCCTATCTCACCTGCCCCCTGGAG 2674 Forward [26]
M105R2843 ACTGTGGTCCTGGTGTCA 2800 Reverse This study
M105VP1F419 AATCATGGCTTAGCTG 3000 Forward This study
M105VP1F540 CCGGAACCTCAAACCA 3200 Forward This study
M105VIPR768 ACAGTAGGTCTCGGACA 3354 Reverse This study
EMCV-P9 ATCAAGACTCCAGCTCTCGGGGTCA 3529 Reverse [26]
M105Middle-F505 AACCCGTGGAAGAGAACCT 3710 Forward This study
EMC-2B65R TCGGCAGTAGGGTTTGAG 3975 Reverse [26]
M105F4204 ATTGCAGGAATGACAATT 4200 Forward This study
M105Contiq3-R335 AGTTGCAGGGTTTTTGGTG 5500 Reverse This study
M105Contiq3-F327 CCTGCAACTGCTGGATGT 5839 Forward This study
M105F5906 ACAGGAAAAGATACCGATGT 5980 Forward This study
M105R6000 TAATGGTCCTGAATTAAG 6000 Reverse This study
M105R6500 ATCGAATTTAGACAACACTGC 6500 Reverse This study
M105POLF16 ACACTAGATGATGTAGTTT 7000 Forward This study
M105POLR158 GTCACTGAGGTGAGTT 7460 Reverse This study
EMCV-P1 CCCTACCTCACGGAATGGGGCAAAG 7631 Reverse [13]
EMCV-P2 GGTGAGAGCAAGCCTCGCAAAGACAG 7370 Forward [13]

Yeo et al.

Yeo et al. Virology Journal 2013 10:248   doi:10.1186/1743-422X-10-248

Open Data