Table 4

Primers used for amplifying the genome
NO. Name of primer Sequence Amplification(bp)
1 P1+ TTAAAACAGCCTGTGGGTTGCACC 769 bp
P769- GTGTAGACACTTGCGAACC
2 P719+ CTTGACCCTTAACACAGCTA 914 bp
P1632- GCTCCTTGGTCGTAGTCTAG
3 P1597+ GTGCCTATTAGCCCACTAGAC 973 bp
P2568- ACCTTGCCTGTATCCAGTCGA
4 P2532+ ACAGGTGAGCAGTCATCGACT 815 bp
P3346- CTGTTGTCCAAATTTCCCAAGA
5 P3216+ GTGGATACCTCGCCCGATGC 919 bp
P4134- CACTCTAACCCCTTAGCGGCGT
6 P4043+ CCATCTTAGGTATCCCTATCGC 1003 bp
P5045- TTGTGTTGCCAATGGCGGACC
7 P4969+ GTCAGATACAGTGTGGATACG 909 bp
P5877- CCACCAATGTGAATACCGACAA
8 P5799+ CAACTTTCCTACTAAAGCAGGAC 769 bp
P6567- CCCACGGCTGATCCAGTTATCG
9 P6500+ TGGCTTTCGGACATTTGTATGA 906 bp
P7405- GCTATTCTGGTTATAACAAATTTACC

Wen et al.

Wen et al. Virology Journal 2013 10:115   doi:10.1186/1743-422X-10-115

Open Data